Gene

KWMTBOMO03783  Validated by peptides from experiments

Pre Gene Modal

BGIBMGA010071

Annotation

PREDICTED:_src_substrate_cortactin_isoform_X1_[Papilio_polytes]

Location

Bomo_Chr7(+):1636388-1656409      View in EpiBrowser

Full name

Src substrate cortactin      

Alternative Name

Amplaxin
Oncogene EMS1

Location in the cell

Cytoplasmic   Reliability : 1.63 Nuclear   Reliability : 1.457

CDS

ATGTGGAAAGCTGCTACTAATGTGAAGGCACCAGAGCCTGCTGAAGCAGATGATTGGGAAACAGATCCCGACTATGTTAATGATGTGAGTGAACAGGAACAAAGATGGGGGCCCGCCGGAAGGAATGTTGAGGCAATTGACATGGCAAAATTACGTGAAGAGGTATTTGAAGCTGACAAATTAGCCAAGAAGAAACAGTATGAGGCTGGACCGAAACCTTCATTTGGATATGGTGGCAAATTCGGTGTCCAAGCTGACCGCATGGATAAATCAGCCGTTGGACACGACTATGTTGGCAAGACCGAGAAACACGTTTCGCAGAAAGATTACGCTCAAGGTTTTGGTGGCAAGTTCGGGGTCCAAGCGGATCGCATGGATAAGTCTGCGGTGGGGCACGACTACGTAGCCAAAGTAGAGAAGCACGTTTCGCAAACCGACTACGCGCAGGGCTTCGGAGGCAAGTTCGGCGTCCAAACCGACAGGGTCGACAAGAGCGCGGCGGGCTGGGAGCACCGCGAGCAGGTCGAGAAGCACCCGTCGCAGCGAGACTACGCGGTCGGGTTCGGGGGCAAGTTCGGGGTGCAGGCCGACCGCCAGGACGCCTCCGCGCTGGGCTGGGACCACAAGGAGGACGCGCAACAACATCACTCGCAGAAAGACTACGCCATCGGCTTCGGCGGGAAGTTCGGCGTGCAGACGGACCGACAGGACGCGTCGGCCGTCGGCTGGGACCACCAGGAGAAGACGCCCGCGCACGCCAGCCAGCTCGACCACAAGAAGGGCTTCGGCGGTAAGTTCGGCGTGCAGTCGGACCGCGTCGACAAGTCGGCGCACGCCTTCGGGGCCGCGGACAAGGTCGGCACCAACTACACGAGACCGAAGCCCGACATCGGCGGGGCGAAGCCCTCGTCCATACGGGCCAAGTTCGAAAACATGGCCAAGGAAAAAGAAGAGGAGGCGCTGCAGTCGGTGCAGAGGATCCGGCAGCAGAGGGAAAAGATCGACAAGGACATCTCGCTAAAGGAGAGAGAACGCGTAGCCAACAAACCCGAGTCTCCCGAACCTGAAGAGTTGCAGCCCACGCCGGACACACCGACCAGCGTACTGCGAGCCACTCCACACTCCGCAGAGGTCAAAGAAAGAGAAGTCAAGAAAGAGATTGTCCAAGAGGAGATCCCAAGAGAAGAGGCAGCAAGAGAGGAAGACAATGTCACAGTTGGTAATAATGCAAGACAAGAAGCGATTGTGAGGGAAGAGGATGTGAAAGAAGAAACAAAGAACTTGCCCGATGTCACCCTGGTGGGAGAAGCTAAGGAGGGGAAAGAAGAGATGAACCGCCAGCCCACCATTGTGGTGTCTCCGGTGGGGTGGGAGGGGGAGGACGAGGGCGGCGACGAGGAGGACGGCTACACCGCGAGGGCGCTGTACGACTACCAGGCCGCCGCGCCCGACGAGATATCTTTCGATCCTGATGACGTCATCACCAACATCGTCATGATCGACGAGGGTTGGTGGCAGGGATTATGTAAAGGCGCCTACGGTCTGTTCCCGGCTAACTACGTACAGTTACAAGATAAATAG

Protein

MWKAATNVKAPEPAEADDWETDPDYVNDVSEQEQRWGPAGRNVEAIDMAKLREEVFEADKLAKKKQYEAGPKPSFGYGGKFGVQADRMDKSAVGHDYVGKTEKHVSQKDYAQGFGGKFGVQADRMDKSAVGHDYVAKVEKHVSQTDYAQGFGGKFGVQTDRVDKSAAGWEHREQVEKHPSQRDYAVGFGGKFGVQADRQDASALGWDHKEDAQQHHSQKDYAIGFGGKFGVQTDRQDASAVGWDHQEKTPAHASQLDHKKGFGGKFGVQSDRVDKSAHAFGAADKVGTNYTRPKPDIGGAKPSSIRAKFENMAKEKEEEALQSVQRIRQQREKIDKDISLKERERVANKPESPEPEELQPTPDTPTSVLRATPHSAEVKEREVKKEIVQEEIPREEAAREEDNVTVGNNARQEAIVREEDVKEETKNLPDVTLVGEAKEGKEEMNRQPTIVVSPVGWEGEDEGGDEEDGYTARALYDYQAAAPDEISFDPDDVITNIVMIDEGWWQGLCKGAYGLFPANYVQLQDK

Description

Contributes to the organization of the actin cytoskeleton and cell shape (PubMed:21296879). Plays a role in the formation of lamellipodia and in cell migration. Plays a role in the regulation of neuron morphology, axon growth and formation of neuronal growth cones (By similarity). Through its interaction with CTTNBP2, involved in the regulation of neuronal spine density (By similarity). Plays a role in the invasiveness of cancer cells, and the formation of metastases (PubMed:16636290). Plays a role in focal adhesion assembly and turnover (By similarity). In complex with ABL1 and MYLK regulates cortical actin-based cytoskeletal rearrangement critical to sphingosine 1-phosphate (S1P)-mediated endothelial cell (EC) barrier enhancement (PubMed:20861316). Plays a role in intracellular protein transport and endocytosis, and in modulating the levels of potassium channels present at the cell membrane (PubMed:17959782). Plays a role in receptor-mediated endocytosis via clathrin-coated pits (By similarity). Required for stabilization of KCNH1 channels at the cell membrane (PubMed:23144454).

Subunit

Interacts with SHANK2 and SHANK3 (via its SH3 domain). Also interacts with FGD1. Identified in a complex containing FGFR4, NCAM1, CDH2, PLCG1, FRS2, SRC, SHC1, GAP43 and CTTN. Interacts with ABL2 (By similarity). Interacts with KCNA2 (via non-phosphorylated C-terminus) (PubMed:12151401). Interacts with PLXDC2 and SRCIN1. Interacts with SAMSN1 (via SH3 domain). Interacts (via SH3 domain) with ASAP1 (via Pro-rich region). Interacts (via SH3 domain) with DNM2 (By similarity). Interacts with ACTN1 (By similarity). Interacts with FER (PubMed:9722593). Forms a complex made of ABL1 and MYLK. Interacts with CTTNBP2NL; this interaction may target CTTN to stress fibers. Interacts with CTTNBP2; this interaction may target CTTN at the cell cortex or dendritic spines. Interacts with KCNH1 (PubMed:23144454).

Keywords

3D-structure   Acetylation   Alternative splicing   Cell junction   Cell membrane   Cell projection   Coated pit   Coiled coil   Complete proteome   Cytoplasm   Cytoskeleton   Endocytosis   Isopeptide bond   Membrane   Methylation   Phosphoprotein   Reference proteome   Repeat   SH3 domain   Ubl conjugation  

Feature

chain  Src substrate cortactin
splice variant  In isoform 2 and isoform 3.

Uniprot

A0A437AW43   A0A212EK70   A0A2H1VJG2   A0A194QDD6   H9JKM1   F1NU55   + More
A0A1W7RIB1   A0A098M101   J3SE71   A0A0F7ZCU6   T1DNE3   A0A0K8RXS6   A0A0B8RR76   A0A3Q2UHE4   A0A094KJF5   A0A091TJ36   A0A093NL54   A0A087QJY4   A0A093HBP7   U3JF68   A0A1S3PTA1   H0Z578   A0A226N6W0   A0A091QKB6   A0A1S3PRW8   A0A182G9C3   A0A091FMK2   A0A0A0AL79   A0A218UVW1   A0A091W830   A0A091IXM1   A0A093PCE8   A0A146P769   Q5M8F8   A0A1S3PS18   A0A401RTC0   A0A1L8GTH8   A0A3B1KJT1   F6ZBN2   A0A1S3PRY0   A0A287B8E9   A0A3Q1LU90   A0A0P6JAC1   A0A3Q1MR68   A0A3Q1FUY5   A0A2R9CGC5   A0A2J8U0Y9   A0A2K5UKD1   K7CI46   F6ZBM4   A0A452G9B4   Q14247-3   A0A024R5M3   A0A452G982   Q5R464   A0A2K6QXK9   A0A2K6M9B5   A0A2K6CYR9   H2NCJ1   I0FPV1   A0A287AUL3   A0A2K5XCQ7   A0A096MPW6   A0A2Y9PIU2   A0A091DB57   A0A3Q0T9U2   A0A2J8U0Z3   A0A2K5J5J6   A0A2U3V305   A0A2K6EPF1   A0A2I3SZG3   Q14247-2  

Pubmed

22118469    26354079    19121390    15592404    26358130    23025625    + More
23758969    25727380    25476704    20360741    26483478    20431018    30297745    27762356    25329095    17431167    30723633    19393038    22722832    25319552    1532244    8474448    14702039    16554811    15489334    9722593    12408982    12151401    15144186    15574754    15561106    15592455    17081983    16964243    17487921    17959782    18220336    18088087    18691976    18669648    19413330    19146815    19690332    19608861    20861316    20068231    21269460    21296879    21406692    23144454    23186163    24275569    25114211    28112733    16636290    11181995    25362486    16136131   

EMBL

RSAL01000347    RVE42301.1    AGBW02014315    OWR41887.1    ODYU01002900    SOQ40967.1    + More
KQ459167    KPJ03472.1    BABH01024757    BABH01024758    BABH01024759    AADN05000303    GDAY02000543    JAV50870.1    GBSI01000602    JAC95894.1    JU174235    AFJ49761.1    GBEX01000793    JAI13767.1    GAAZ01000577    JAA97366.1    GBKC01000820    GBKD01000518    JAG45250.1    JAG47100.1    GBSH01000721    JAG68304.1    KL260555    KFZ59443.1    KK453155    KFQ74819.1    KL224691    KFW62685.1    KL225684    KFM01538.1    KK622919    KFV52098.1    AGTO01011713    ABQF01001459    MCFN01000175    OXB63238.1    KK663895    KFQ09939.1    JXUM01153871    JXUM01153872    KQ571811    KXJ68107.1    KL447132    KFO70181.1    KL872041    KGL94308.1    MUZQ01000123    OWK57482.1    KK735000    KFR11797.1    KL218315    KFP04341.1    KL668708    KFW74081.1    GCES01154041    GCES01146605    JAQ32281.1    JAQ39717.1    AAMC01035418    AAMC01035419    BC088042    AAH88042.1    BEZZ01002206    GCC21402.1    CM004471    OCT87145.1    JSUE03011906    JSUE03011907    AEMK02000006    DQIR01123072    DQIR01187305    HDA78548.1    GEBF01002428    JAO01205.1    AJFE02101763    AJFE02101764    AJFE02101765    NDHI03003478    PNJ38940.1    AQIA01019582    GABC01003640    GABF01006396    GABD01004718    GABE01002498    NBAG03000050    JAA07698.1    JAA15749.1    JAA28382.1    JAA42241.1    PNI93234.1    JU333318    JU473475    AFE77073.1    AFH30279.1    LWLT01000026    M98343    AK291097    AP000487    CH471076    BC008799    BC033889    EAW74769.1    CR861394    CAH93452.1    ABGA01352559    ABGA01352560    ABGA01352561    ABGA01352562    ABGA01352563    ABGA01352564    JV046406    AFI36477.1    AHZZ02006212    KN122776    KFO28297.1    PNJ38942.1    AACZ04016249    PNI93235.1   

Proteomes

UP000283053    UP000007151    UP000053268    UP000005204    UP000000539    UP000054081    + More
UP000053286    UP000016665    UP000087266    UP000007754    UP000198323    UP000069940    UP000249989    UP000053760    UP000053858    UP000197619    UP000053605    UP000054308    UP000053258    UP000008143    UP000287033    UP000186698    UP000018467    UP000006718    UP000008227    UP000009136    UP000257200    UP000240080    UP000233100    UP000291000    UP000005640    UP000233200    UP000233180    UP000233120    UP000001595    UP000233140    UP000028761    UP000248483    UP000028990    UP000261340    UP000233080    UP000245320    UP000233160    UP000002277   

PRIDE

H9JKM1    Q14247    A0A024R5M3   

Pfam

PF02218   HS1_rep        + More
PF14604   SH3_9
PF00018   SH3_1

Interpro

IPR001452   SH3_domain        + More
IPR003134   Hs1_Cortactin       
IPR036028   SH3-like_dom_sf       
IPR035716   Cortactin_SH3       
IPR015503   Cortactin       
IPR028534   HS1       

SUPFAM

SSF50044   SSF50044       

CDD

cd11959  SH3_Cortactin

ProteinModelPortal

A0A437AW43   A0A212EK70   A0A2H1VJG2   A0A194QDD6   H9JKM1   F1NU55   + More
A0A1W7RIB1   A0A098M101   J3SE71   A0A0F7ZCU6   T1DNE3   A0A0K8RXS6   A0A0B8RR76   A0A3Q2UHE4   A0A094KJF5   A0A091TJ36   A0A093NL54   A0A087QJY4   A0A093HBP7   U3JF68   A0A1S3PTA1   H0Z578   A0A226N6W0   A0A091QKB6   A0A1S3PRW8   A0A182G9C3   A0A091FMK2   A0A0A0AL79   A0A218UVW1   A0A091W830   A0A091IXM1   A0A093PCE8   A0A146P769   Q5M8F8   A0A1S3PS18   A0A401RTC0   A0A1L8GTH8   A0A3B1KJT1   F6ZBN2   A0A1S3PRY0   A0A287B8E9   A0A3Q1LU90   A0A0P6JAC1   A0A3Q1MR68   A0A3Q1FUY5   A0A2R9CGC5   A0A2J8U0Y9   A0A2K5UKD1   K7CI46   F6ZBM4   A0A452G9B4   Q14247-3   A0A024R5M3   A0A452G982   Q5R464   A0A2K6QXK9   A0A2K6M9B5   A0A2K6CYR9   H2NCJ1   I0FPV1   A0A287AUL3   A0A2K5XCQ7   A0A096MPW6   A0A2Y9PIU2   A0A091DB57   A0A3Q0T9U2   A0A2J8U0Z3   A0A2K5J5J6   A0A2U3V305   A0A2K6EPF1   A0A2I3SZG3   Q14247-2  

PDB

5NXJ     E-value=4.93835e-20,     Score=242

KEGG

101743527    K06106 cortactin | (RefSeq) src substrate cortactin

GO

GO:0030041   GO:0003779   GO:2001237   GO:0005829   GO:0097062   GO:0006930   GO:0001726   GO:0005794   GO:0002102   GO:0005522   GO:0005884   GO:0008076   GO:1903146   GO:1990023   GO:0045987   GO:0030027   GO:0006886   GO:0030863   GO:0030838   GO:0030516   GO:0061024   GO:0005938   GO:0005856   GO:0048870   GO:0043197   GO:0045296   GO:0048812   GO:0005905   GO:0005737   GO:0006898   GO:0005925   GO:0097581   GO:0048041   GO:0031532   GO:0043231   GO:0005886   GO:0005515   GO:0008152   GO:0030136   GO:0030276   GO:0048268   GO:0000049   GO:0004812   GO:0043039   GO:0042555   GO:0048384  

PANTHER

PTHR10829:SF15   PTHR10829:SF5  

Subcellular location

Cytoplasm   Colocalizes transiently with PTK2/FAK1 at focal adhesions (By similarity). Associated with membrane ruffles and lamellipodia. In the presence of CTTNBP2NL, colocalizes with stress fibers (By similarity). In the presence of CTTNBP2, localizes at the cell cortex (By similarity). In response to neuronal activation by glutamate, redistributes from dendritic spines to the dendritic shaft (By similarity). Colocalizes with DNM2 at the basis of filopodia in hippocampus neuron growth zones (By similarity).   With evidence from 20 publications.
Cytoskeleton   Colocalizes transiently with PTK2/FAK1 at focal adhesions (By similarity). Associated with membrane ruffles and lamellipodia. In the presence of CTTNBP2NL, colocalizes with stress fibers (By similarity). In the presence of CTTNBP2, localizes at the cell cortex (By similarity). In response to neuronal activation by glutamate, redistributes from dendritic spines to the dendritic shaft (By similarity). Colocalizes with DNM2 at the basis of filopodia in hippocampus neuron growth zones (By similarity).   With evidence from 20 publications.
Cell projection   Colocalizes transiently with PTK2/FAK1 at focal adhesions (By similarity). Associated with membrane ruffles and lamellipodia. In the presence of CTTNBP2NL, colocalizes with stress fibers (By similarity). In the presence of CTTNBP2, localizes at the cell cortex (By similarity). In response to neuronal activation by glutamate, redistributes from dendritic spines to the dendritic shaft (By similarity). Colocalizes with DNM2 at the basis of filopodia in hippocampus neuron growth zones (By similarity).   With evidence from 20 publications.
Lamellipodium   Colocalizes transiently with PTK2/FAK1 at focal adhesions (By similarity). Associated with membrane ruffles and lamellipodia. In the presence of CTTNBP2NL, colocalizes with stress fibers (By similarity). In the presence of CTTNBP2, localizes at the cell cortex (By similarity). In response to neuronal activation by glutamate, redistributes from dendritic spines to the dendritic shaft (By similarity). Colocalizes with DNM2 at the basis of filopodia in hippocampus neuron growth zones (By similarity).   With evidence from 20 publications.
Ruffle   Colocalizes transiently with PTK2/FAK1 at focal adhesions (By similarity). Associated with membrane ruffles and lamellipodia. In the presence of CTTNBP2NL, colocalizes with stress fibers (By similarity). In the presence of CTTNBP2, localizes at the cell cortex (By similarity). In response to neuronal activation by glutamate, redistributes from dendritic spines to the dendritic shaft (By similarity). Colocalizes with DNM2 at the basis of filopodia in hippocampus neuron growth zones (By similarity).   With evidence from 20 publications.
Dendrite   Colocalizes transiently with PTK2/FAK1 at focal adhesions (By similarity). Associated with membrane ruffles and lamellipodia. In the presence of CTTNBP2NL, colocalizes with stress fibers (By similarity). In the presence of CTTNBP2, localizes at the cell cortex (By similarity). In response to neuronal activation by glutamate, redistributes from dendritic spines to the dendritic shaft (By similarity). Colocalizes with DNM2 at the basis of filopodia in hippocampus neuron growth zones (By similarity).   With evidence from 20 publications.
Cell membrane   Colocalizes transiently with PTK2/FAK1 at focal adhesions (By similarity). Associated with membrane ruffles and lamellipodia. In the presence of CTTNBP2NL, colocalizes with stress fibers (By similarity). In the presence of CTTNBP2, localizes at the cell cortex (By similarity). In response to neuronal activation by glutamate, redistributes from dendritic spines to the dendritic shaft (By similarity). Colocalizes with DNM2 at the basis of filopodia in hippocampus neuron growth zones (By similarity).   With evidence from 20 publications.
Podosome   Colocalizes transiently with PTK2/FAK1 at focal adhesions (By similarity). Associated with membrane ruffles and lamellipodia. In the presence of CTTNBP2NL, colocalizes with stress fibers (By similarity). In the presence of CTTNBP2, localizes at the cell cortex (By similarity). In response to neuronal activation by glutamate, redistributes from dendritic spines to the dendritic shaft (By similarity). Colocalizes with DNM2 at the basis of filopodia in hippocampus neuron growth zones (By similarity).   With evidence from 20 publications.
Cell junction   Colocalizes transiently with PTK2/FAK1 at focal adhesions (By similarity). Associated with membrane ruffles and lamellipodia. In the presence of CTTNBP2NL, colocalizes with stress fibers (By similarity). In the presence of CTTNBP2, localizes at the cell cortex (By similarity). In response to neuronal activation by glutamate, redistributes from dendritic spines to the dendritic shaft (By similarity). Colocalizes with DNM2 at the basis of filopodia in hippocampus neuron growth zones (By similarity).   With evidence from 20 publications.
Focal adhesion   Colocalizes transiently with PTK2/FAK1 at focal adhesions (By similarity). Associated with membrane ruffles and lamellipodia. In the presence of CTTNBP2NL, colocalizes with stress fibers (By similarity). In the presence of CTTNBP2, localizes at the cell cortex (By similarity). In response to neuronal activation by glutamate, redistributes from dendritic spines to the dendritic shaft (By similarity). Colocalizes with DNM2 at the basis of filopodia in hippocampus neuron growth zones (By similarity).   With evidence from 20 publications.
Membrane   Colocalizes transiently with PTK2/FAK1 at focal adhesions (By similarity). Associated with membrane ruffles and lamellipodia. In the presence of CTTNBP2NL, colocalizes with stress fibers (By similarity). In the presence of CTTNBP2, localizes at the cell cortex (By similarity). In response to neuronal activation by glutamate, redistributes from dendritic spines to the dendritic shaft (By similarity). Colocalizes with DNM2 at the basis of filopodia in hippocampus neuron growth zones (By similarity).   With evidence from 20 publications.
Clathrin-coated pit   Colocalizes transiently with PTK2/FAK1 at focal adhesions (By similarity). Associated with membrane ruffles and lamellipodia. In the presence of CTTNBP2NL, colocalizes with stress fibers (By similarity). In the presence of CTTNBP2, localizes at the cell cortex (By similarity). In response to neuronal activation by glutamate, redistributes from dendritic spines to the dendritic shaft (By similarity). Colocalizes with DNM2 at the basis of filopodia in hippocampus neuron growth zones (By similarity).   With evidence from 20 publications.
Dendritic spine   Colocalizes transiently with PTK2/FAK1 at focal adhesions (By similarity). Associated with membrane ruffles and lamellipodia. In the presence of CTTNBP2NL, colocalizes with stress fibers (By similarity). In the presence of CTTNBP2, localizes at the cell cortex (By similarity). In response to neuronal activation by glutamate, redistributes from dendritic spines to the dendritic shaft (By similarity). Colocalizes with DNM2 at the basis of filopodia in hippocampus neuron growth zones (By similarity).   With evidence from 20 publications.
Cell cortex   Colocalizes transiently with PTK2/FAK1 at focal adhesions (By similarity). Associated with membrane ruffles and lamellipodia. In the presence of CTTNBP2NL, colocalizes with stress fibers (By similarity). In the presence of CTTNBP2, localizes at the cell cortex (By similarity). In response to neuronal activation by glutamate, redistributes from dendritic spines to the dendritic shaft (By similarity). Colocalizes with DNM2 at the basis of filopodia in hippocampus neuron growth zones (By similarity).   With evidence from 20 publications.

Length:

526

Number of predicted TMHs:

0

Exp number of AAs in TMHs:

0.01941

Exp number, first 60 AAs:

0

Total prob of N-in:

0.01005

outside

1  -  526

 

 

Pi

190.522011

Theta

20.567338

Tajima's D

1.22548

CLR

101.880599

CSRT

0.727763611819409

Interpretation

Uncertain