SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03765
Annotation
PREDICTED:_uncharacterized_protein_LOC101737183_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.295 Nuclear   Reliability : 1.799
 

Sequence

CDS
ATGTCCCCGGCAGCTCTCTGGTTGCTAAAGGGGAAGGCCCTCCAGAGGGGGGTACCAGTACGCCGGCGTGGCCACATCATGGTCAGACGTGTGGGTCTGTCAGTAATGGCAGACCCCAAGAGGATGAGAAGTGAACCGGAGGGCACTCCCTTCCGGTCGCTGGTTGCCATGTCCCCGGTTGCCTCTTGGCAGCTACAGGGGAAGGCCCTCCAGAGGGGGGTACCGGTTTACCGGCGTGGCTTCGTAGAAGCATACCGTAATCCCTACCGAGTAGGGGACGGGGGCCGCGAGGATGCGAACCTCTATAAAAAATGCCCTAATCCTAAGCTTGTGACGTGCCCGGAGGGTACCACCCTAGGTGGAGAATCCCTCCGTGCTTCCACCTTGGTGGGAGCACGCAGCCCCGCGTATTCTGGGGGGGGCAAAGCTTGCCAGGACGAAGGGGGCTGTGTGACGGGCAGCGGAAAACCCGTCGAACAGAGATACGCCAGCGCTGACTTGACGCCTTCTGGGCTCGTCAGTGACAGCGAGGCGGCTGGCTCGAAAGAGACAACCGCCAAAAAGATAAGGCGGAAAAGAAAATCCCAGCGAGTTTCCTCACGCGAGGGGGGAGGGGAGCCAGCGTCATCCTCTGGCGCAGATGCCCCGCCGGAGAAGGTACTGGTAGTCTCCGATGCGGCCTCTGCTGCGGAGGACATGCCGCCACCTAAAGAAAGACCCGCCCGGAGGAGAGGCGCGCCGTCACCGGCGCAGTCATCGGCGTCGATGTCTGTCGCCTCACTGGACGGGCGAACGACAGAGGAGGAAGATGGCGGCCTTCAAGACCCTGCCTTGGTCATAGACAGGGCCATGAGGACCGTCAAGTCATATGCGGCCAACGGCACTAAGACCAAAGCCGCTGGCCGTAAGCTGCGAGAGGTGGTCTCGCAGGTCTCGAAGGTTCTGCCTTCGGTTGCTTCCGCCAATGACCAGGTGGTACAGCTGATGGCGGAGAATTCGAGGCTTCGAGCACTACTTCAAGCCCAACAGCAGCCTGGTGATGAGGCTGCTGCTTCGAGGAGGGCAGCGGCGTCGACGCCGTCGCCCGCGTTGCCCCGGGCCACTGGGTTGCGGACTCCTCGGGCTCCTGTACCGGCAGCGACGTCATGTATCGCCGGGGCCCCTCGGAGTCACCGTTCTCCGGCGCTGACTGGCGATGGGTGGCCTGTGCTGCCGCCACCGCGCGCGGCTGAGCAGGGTCCACGTCTCCCGTCACCGCGCACTAGAGAGATGACCGTTACCAAGCGGCAGCAGGCACTCGTGGGGCCACGGGAGCTAGCTGGAAAGTTCAGCCTGAACGAGGTCATCAGTCGCACTGTCCAGGTTGTACTAGAAAGGCTGGACGGCAGGCTGGCGGCCCTCGAGGCGCAGCTCATTGCTCCGGCTGACGCTCGGCGACCGGCATATGCCGCGGTGTCGGGTACTCCAGCCGCTCGCCCCGCCCCCGTACGGGCTCCAGCTACTAAGTTGGGCCCGGGACGGGATAGAACCAAACGGGGGGGCGGTGCCAACTCGAAACGACCATCGCAAGCACCCCAGCCCCGTCCGCTGTCTCCGCCTCCGTCTAACATGGACGAGGGGTGGAACGTGGTGGCCCGGCGGGGTAACAAGAAGGCCCCATTGACAGCTCCACAAGTGGGTGGAGCGCCCGCGGCCACGGCGGCTCAGGCTGCTCCCCAACAGGGTCGAGCGCCTGCAGCCGCCAAAAATAAAAATAAAAACAAAAAAACAAAGAAGCCACCGCGCGCGCCGCGATCGGCGGCAGTGGTCCTAACGCTGCTGCCGGCTGCCAAAGCAAAGGGCATGACATACGGAGATACAGCCAATGGGGCCAAGCTGCTAGAATGTCCCGTTGCCGACAGTGCCGGCATCGCGGAGCGTCTGGCGGCAAGGCTCCGTATGGTTCTGCCTGAAGAGGAGGTGCGGGTGCATAGGCCGGTCAAGATGGCTGAATTGAGAGTGACCGGCCTGGACGACTGCACCACCAGGGATGAGGTGGCGGCGGCCGTCGCTGCCCAGGGCAACTGTGCCCCGCAGAATATAACCGTAGGCGAGCTGCGCTCTGGTTATACCGGGGCCGGCTCCGTGTGGGTACGTTGCCCGGTGGAGGCGGCCGTCGCCCTGGCTACTCCTCCGCCTGGGAGACCGTCGGGGGATCCGGGCAGGTTGCGCGTGGGCTGGATAGCAGCCCACGTGCGCCTGCTAGAACCGCGTGCCTGGCGGTGCCTAAGGTGCTTCAGCACTGGGCACTGCCTCGCCAAGTGCGTGAGTGCGGTTGACCGCAGTGGACTGTGTTTCCGCTGTGGTCAGCCTGGACACAAGGCGGCCGTGTGCTTGGCTGCGCCGCATTGTTCACTATGCGCGGCGGCCGGACGCAAGGCTGATCACCGGACCGGGGGCAAGGCATGCCCCCCGGCCGGCAAAAATGCAATTCGAAATTGGCGCCGCCAAGCTAAGCGGCGCCAAAAGAAGCGGTGGGCATTGAAGCTCCTGAAGAAGGAGCTCCTGGTGGAGGCCTCTATAGTGGCGGCGTGGACGCCCATGCGTCCACACCCTTTCGACGTGGAGGCTGAGGCCGAATGGTTCCGCGGCGCGATGCACCGCATATGCGATGCCTCGATGCCCCGGGTCGGCCCTCGGCATTGTGGACGGCGGCAGTCGCCCTGGTGGTCGCCCGAAATTGCGAGACTGCGTGCAGTCTCCATTCGGGCGAGCCGCCGGTGCGCTAGACACCGCCGTCGCCGCCACTTGCGGCGCGACGGCCCCGTCGCGTTCGCGGAGGAGGAGACCCGGCTGCACGGCGAATATCGTGCTGCGAAGGACGCCCTGCGGCTGGCCATCAGGCGGGCCAAGGAGCAGAACATGGAGAGACTCTTGGAGGCGCTCGAAGCGGATCCATGGGGGAGCCCGTATAGGCTGGAGCGGGAGGGTTTTGTTCCCCCTGCTATGGGTGAGCCGTCGGACGCCATCGACGGCGAAGCCCCTGCTGAGGTGCCCCGTATCACTGGGGCAGAGCTCCGTGTGGCCGTTGTCAGGATGACTGCAAAGGACACGGCCCCCGGCCCGGACGGAGTCCATGGCCGGGTGCTGGCCTTGGCCCTCGATGCCCTGGGGGACCGGCTCCTGGAGCTATTTAATGGTTGCCTGGAGTCGGGACGGTTTCCGTTGCTCTGGCGGACAGGCAGACTTGTGTTGTTAAGAAAGGAGGGGCGCCCGGTGGATACAGCCGCCGGGTATCGTCCTATCGTACTGCTGGACGAGGCGGGAAAATTGCTGGAGCGTATTCTGGCTGCCCGCATCGTTCAGCACCTGGTCGGGGTTGGACCTGACCTGTCGGCGGAGCAGTTCGGCTTCCGGGAGGGCCGTTCGACCGTGGATGCAATACTTCGCGTGCGGGCCCTCTCGGACGAGGCTGTCTCACGGGGTGGGGTGGCGCTGGCGGTGTCTCTTGACATCGCCAACGCATTTAACACCCTGCCCTGGTCTGTGATAGGGGGGGCACTGGAGAGGCATGGAGTGCCCCTCTACCTCCGCCGGCTGGTTGGCTCCTATTTGGAGGCCAGGTCGGTCGAATGTACCGGGTACGGTGGGACCCTTCACCGTTTTCCGGTCGTGCGTGGTGTTCCACAGGGGTCGGTTCTCGGACCCCTCTTGTGGAACATCGGGTACGACTGGGTGCTGAGGGGTGCCCTCCTCCCGGGCCTCCGTGTTATTTGTTACGCGGACGACACTTTGGTCGTGGCCCGGGGGGATGATTATAGAGAGTCTGCCCGTCTCGCCACAGCGGGAGTGGCCCTCGTCGTCGGGAGGATAAAGAGACTGGGCCTCGACGTGGCGCTCAGTAAATCCGAGGCCTTGTGGTTTCACGGGCCGCGGAGAGCGCCACCTGTCGACGCCCACATCGTGGTTGGGGGCGTCCGGATAGGGGTCGGGGTGCAGTTAAGGTACCTCGGCCTCGTGTTGGACGGCCGGTGGGCTTTTCGTGCTCACTTTGCGGAGCTGGTCCCCCGGTTAATGAGGACGGCCGGTTCTTTGAACCGACTGCTCCCAAATATCGGGGGGCCGGATCAGGTTGTACGCCGCCTCTACGCTGGGGTGGTGCGATCGATGGCCCTGTACGGTGCGCCTGTATGGGCTGAGCCGCGCAATCGGGCTACTATGGCTCGGTTCCTGCGCCGGCCGCAGCGCACCGTTGCTATCAGGGTCATTCGTGGATATCGCACCGTCTCATTCGAGGCGGCGTGTGTGTTGGCGGGGACGCCGCCATGGGAGCTGGAGGCGGAGTCGCTCGCTGCCGACTATCGGTGGCGCAGTGAGCTTCGTGCTCTGGGCGTGGCGCGTCCCTCCAAAAGTGAGCTGCGGGCGCGGAAGGCCCATTCTCGGCGGTCCGTGCTCGAATCGTGGTCGAGGCGGTTGGCCAACCCCACGTGGGGTCTACGGACCGTCGAGGCGGTTTACCCAGTCTTTTATGACTGGGTGAATCGTGGCCGAGGACGCCTCACCTTCCGTCTGGTGCAGGTGCTGACTGGGCACGGATGCTTCGGAAAGTACCTGCACCGGATAGGAGCTGAGCCGACGACGAGGTGCCACCATTGTGGACACGACCTGGACACGGCGGAGCATACGCTCGCTGTCTGCCCCGCATGGGAGGTGCAGCGCCGTGTCCTTGTCGCAAAGATAGGACCAGACTTGTCGCTGCCTGGCGTCGTGGCGTCGATGCTTGGCGGCGACGAGTCTTGGAAGGCTATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGAGTGAGGCAAAGCTCTCCTCACTACGCAGAAACCCGCCGCCGCCGAGCAGGGGGTCGGGACCGGGGTCCCGTCCGTGACCCGGCCCCCTAA
Protein
MSPAALWLLKGKALQRGVPVRRRGHIMVRRVGLSVMADPKRMRSEPEGTPFRSLVAMSPVASWQLQGKALQRGVPVYRRGFVEAYRNPYRVGDGGREDANLYKKCPNPKLVTCPEGTTLGGESLRASTLVGARSPAYSGGGKACQDEGGCVTGSGKPVEQRYASADLTPSGLVSDSEAAGSKETTAKKIRRKRKSQRVSSREGGGEPASSSGADAPPEKVLVVSDAASAAEDMPPPKERPARRRGAPSPAQSSASMSVASLDGRTTEEEDGGLQDPALVIDRAMRTVKSYAANGTKTKAAGRKLREVVSQVSKVLPSVASANDQVVQLMAENSRLRALLQAQQQPGDEAAASRRAAASTPSPALPRATGLRTPRAPVPAATSCIAGAPRSHRSPALTGDGWPVLPPPRAAEQGPRLPSPRTREMTVTKRQQALVGPRELAGKFSLNEVISRTVQVVLERLDGRLAALEAQLIAPADARRPAYAAVSGTPAARPAPVRAPATKLGPGRDRTKRGGGANSKRPSQAPQPRPLSPPPSNMDEGWNVVARRGNKKAPLTAPQVGGAPAATAAQAAPQQGRAPAAAKNKNKNKKTKKPPRAPRSAAVVLTLLPAAKAKGMTYGDTANGAKLLECPVADSAGIAERLAARLRMVLPEEEVRVHRPVKMAELRVTGLDDCTTRDEVAAAVAAQGNCAPQNITVGELRSGYTGAGSVWVRCPVEAAVALATPPPGRPSGDPGRLRVGWIAAHVRLLEPRAWRCLRCFSTGHCLAKCVSAVDRSGLCFRCGQPGHKAAVCLAAPHCSLCAAAGRKADHRTGGKACPPAGKNAIRNWRRQAKRRQKKRWALKLLKKELLVEASIVAAWTPMRPHPFDVEAEAEWFRGAMHRICDASMPRVGPRHCGRRQSPWWSPEIARLRAVSIRASRRCARHRRRRHLRRDGPVAFAEEETRLHGEYRAAKDALRLAIRRAKEQNMERLLEALEADPWGSPYRLEREGFVPPAMGEPSDAIDGEAPAEVPRITGAELRVAVVRMTAKDTAPGPDGVHGRVLALALDALGDRLLELFNGCLESGRFPLLWRTGRLVLLRKEGRPVDTAAGYRPIVLLDEAGKLLERILAARIVQHLVGVGPDLSAEQFGFREGRSTVDAILRVRALSDEAVSRGGVALAVSLDIANAFNTLPWSVIGGALERHGVPLYLRRLVGSYLEARSVECTGYGGTLHRFPVVRGVPQGSVLGPLLWNIGYDWVLRGALLPGLRVICYADDTLVVARGDDYRESARLATAGVALVVGRIKRLGLDVALSKSEALWFHGPRRAPPVDAHIVVGGVRIGVGVQLRYLGLVLDGRWAFRAHFAELVPRLMRTAGSLNRLLPNIGGPDQVVRRLYAGVVRSMALYGAPVWAEPRNRATMARFLRRPQRTVAIRVIRGYRTVSFEAACVLAGTPPWELEAESLAADYRWRSELRALGVARPSKSELRARKAHSRRSVLESWSRRLANPTWGLRTVEAVYPVFYDWVNRGRGRLTFRLVQVLTGHGCFGKYLHRIGAEPTTRCHHCGHDLDTAEHTLAVCPAWEVQRRVLVAKIGPDLSLPGVVASMLGGDESWKAMLDFCECTISQKEAAGRVRQSSPHYAETRRRRAGGRDRGPVRDPAP

Summary

Uniprot
ProteinModelPortal
PDB
6AR3     E-value=1.18105e-05,     Score=123

Ontologies

Topology

Length:
1641
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01223
Exp number, first 60 AAs:
0.00024
Total prob of N-in:
0.00002
outside
1  -  1641
 
 

Population Genetic Test Statistics

Pi
11.447256
Theta
100.802117
Tajima's D
0
CLR
2.391678
CSRT
0.372581370931453
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号