SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03742
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 3.193
 

Sequence

CDS
ATGTCGGCGCGCGACCGTCCGATTAGTCTCCTCCCGACGATAGGAAAAATTTACGAACGGCTCCTTAGGAAACGCCTCTGGGATTTTGTTACCGCGAACAAAATTCTCATAGACGAACAGTTCGGATTCCGCTCTAAACACTCGTGCGTACAACAAGTGCACCGCCTCACGGAGCACATCCTGATAGGACTAAATAGGCGTAAACAAATCCCGACCGGCGCCCTCTTCTTCGACATCGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTAATTTACAAACTGTACAACATGGGAGTGCCAGACAGACTCGTGCTCATCATACGAGACTTCTTGTCGAACCGTTCGTTTCGATATCGAGTAGAGGGAACTCGTTCTCGTCCCCGTCAACTGACTGCCGGAGTCCCGCAAGGCTCCGCGCTCTCCCCGTTATTATTTAGTTTGTATATCAATGATATACCCCGGTCTCCGGAGACCCATCTAGCGCTCTTCGCCGATGACACGGCTATCTACTACTCGTGTAGGAAGATGTCGCTGCTTCATCGGCGACTCCAGATCGCAGTAGCCACCATGGGACAGTGGTTCCGGAAGTGGCGCATCGACATCAACCCCACGAAAAGCACAGCGGTCCTCTTCAAAAGGGGTCGCCCTCCGAATACCACTTCGAGCATCCCACTCCCTAATAGGCGCGCAAACACCTCCGCTGTTAGCCCCGTCACTCTCTTTGGCCAGCCCATACCGTGGGCCTCGCAGGTCAAATACCTAGGCGTCACCCTCGACAGAGGGATGACATTCCGTCCCCATATTAAAACGGTACGCGACCGTGCCGCCTTCATATTAGGACGTCTCTACCCTATGCTTTGCAAGCGAAGCAAACTGTCCCTCCGTAATAAGGTAACTCTCTACAAAACTTGCATACGCCCCGTTATGACGTATGCAAGCGTAGTGTTCGCTCACGCAGCCCGCACCAACTTGAAGCCCCTTCAGGTTATTCAATCCCGATTCTGCAGGATAGCCGTCGGAGCACCATGGTTCCTGAGGAACGTGGATCTCCACGATGACCTGGAGCTTGACTCTGTCAGTAAGTATCTACAGTCGGCATCGCTGCGCCATTTTGAGAAGGCGGCACGACATGAGAACCCTCTCATCGTAGCCGCTGGAAATTACATACCCGACCCAGTAGACCGAATGGATGCAGTAGAATTTGTCATTGGGAGCATTGGAGATGAACGGATTCGGACAGAACTGCTCAATAGCAAGTCAAATACTGTTCCGGAGTTAATTGCTATAGCCAAAACGTTTCGCAAACGAAAGAATATACCAACTAAATCGACTGAGTTCAGTAAGCAACCTCGTTTGAACTTTAATCGTGATAGATCCAACTTGACTTGTCATGTTCGTGGAAAAACAGGAACGAAATGGATATGGACTGCCTTTCACGAAGCAACAAGATTAAACATAATCGATTACCGTACCTGCGCGCTGCTTCATACCATGTTCAAAGAGGGCGTACCAATTGAACTTCATACAGATGCAAGTGATGCTGATCCAACTATCACTCATATGAATTGGAGACTGTGGCTGTTAGACGAAGTTTTGTGCCAAAAAGTTAAGCTGGAGAATGGAAGAACTAAGACTCTAAAAGCGGTACCACAATGCTACCAATGGAGTATCATAAATAATTACCACAAAGTTTTAAAACACTTTGGCTGGGAGAAAGCACTCGAAAAACTCAAAGAACACTTTTGGTCTGACAAATTGAGCTCAAAAGTTCGCAGCTTCATAGACAATTGCGTGTACGGCATTGAACTGCACCACATCGTAGCATACACGAATAGATCAAACGGCCAGGCCAAAAGAATTTTCCACATCGTTAAAGATGGACTCACTGTCATTAGTAATATTCAGCAGGATCACTGGGAACACAACTTGCTATTAACTCTACAGTACCTATCCAAAGCAACTGGGAAAGCACCTATGGAATGGAGCTAA
Protein
MSARDRPISLLPTIGKIYERLLRKRLWDFVTANKILIDEQFGFRSKHSCVQQVHRLTEHILIGLNRRKQIPTGALFFDIAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDFLSNRSFRYRVEGTRSRPRQLTAGVPQGSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKMSLLHRRLQIAVATMGQWFRKWRIDINPTKSTAVLFKRGRPPNTTSSIPLPNRRANTSAVSPVTLFGQPIPWASQVKYLGVTLDRGMTFRPHIKTVRDRAAFILGRLYPMLCKRSKLSLRNKVTLYKTCIRPVMTYASVVFAHAARTNLKPLQVIQSRFCRIAVGAPWFLRNVDLHDDLELDSVSKYLQSASLRHFEKAARHENPLIVAAGNYIPDPVDRMDAVEFVIGSIGDERIRTELLNSKSNTVPELIAIAKTFRKRKNIPTKSTEFSKQPRLNFNRDRSNLTCHVRGKTGTKWIWTAFHEATRLNIIDYRTCALLHTMFKEGVPIELHTDASDADPTITHMNWRLWLLDEVLCQKVKLENGRTKTLKAVPQCYQWSIINNYHKVLKHFGWEKALEKLKEHFWSDKLSSKVRSFIDNCVYGIELHHIVAYTNRSNGQAKRIFHIVKDGLTVISNIQQDHWEHNLLLTLQYLSKATGKAPMEWS

Summary

Uniprot
ProteinModelPortal
PDB
6AR3     E-value=0.00377298,     Score=97

Ontologies

GO

Topology

Length:
663
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.06226
Exp number, first 60 AAs:
0.0003
Total prob of N-in:
0.00302
outside
1  -  663
 
 

Population Genetic Test Statistics

Pi
410.68298
Theta
189.236955
Tajima's D
3.476267
CLR
0.004274
CSRT
0.993600319984001
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号