SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03729
Annotation
reverse_transcriptase_[Danaus_plexippus]
Location in the cell
Nuclear   Reliability : 1.341
 

Sequence

CDS
ATGCGCTCTACGCTCGCCAGTGATTCGGGTGCGATCATCCCCACCAAACCATCGGCGGGGAAAAAGAGGGGCCAAAGGAAGACCCCCGTAGTAACTTCCGACGACGGCGGTGCGTCATCCTCCAGCACTGAGGTGCCGGAAAAGACCATGGCCATCGAGGACGTGGCTCCGGTGATTTCGGGGCCTGCCGCGTCGAAAGACACGATGCCCGCACCCCAGCGGGCACCAGTAAGGAGGAGGGGTGCCGTGTCACCGGCGACATCGGTGGAGTCGATGTCGACGTCGGTTGCGTCTCTGGCTAGCGGGGACGAGACGTTTCGTGATCTCGACCTCGCGCTGGTCAATCTCGGTAAACTGCTGTCAACCGTGGCTGCCAAGGGCGCCCAACCAGGCAGCAGCTACCGGAAAAGGCTTCGGGAGGGAGCCGCTATGGTAAGGACGAGACTGATCCCCACCATGTCCAAGCTCTATGACTTGGTGGCGAGCCGGGAGGCTGAAAACAAAGGCCTCGTCGCACAGCTTGACTCCAGGGAGAGTCGCATCCCGGGGGACTCCTCGGCCTCGCAGGGAGAGACTTCCCTGTCGCCAGTGCCTACGCTGGCATGCTCTGGGCCCTCCGTGGAGGCCAAACAATATGGCTGCTGGGATGGGGGGGTGGATGACTGCCTCCCAAGCAGAGAGGAAATTGTGGCCTGCATCTCGCGGGCGGTGGCGGTTGAGGTCGGCAAGCACTTTGCCGGCCTCGAGGAGATGCTCCGCTCCTCAATTCGTTCCGGAGACTGCATCCCGGTGCCAACAGCCGCGGTCAGCCCGCGGGATCGGGCCGCCCGGCCGACCTCCGCTCCTACCCCACCTGCGAGAGTGGTTCGGCGTGGAGGCCGGAACCAGAACAACAGAGGTGTGAGGGACCAGAATCCCGACCCACGGTCCCAACCACAGCCTCGTCCCCTTCCTCCTCCCCCATCAAGCATGGACGAGGGCTGGACGGAAGTGGTGAGGCGGGGCACCCAGGCATGGCGACAGACAGCGGCTCTGGCAGCTCCCCGGGGGGGTCGAGCGCCGACCGCTGCAGCCCGTAAAACAGCGCTAGCGGCCGTGGCTGCTCCCCGCGAGGGTCGAGCACCAGCCGCTGGCAAGAAGAAAAGCAAGAAGAAGAAGCCGCGTGCAGCGCGGTCGGCTGCCGTTGTAGTGACATTGCTGCCGGCCGCCGCCGAAAAGGGCCTTACCTATAATAATGTGATGGCCCGGGCGCGCGCGGCTGTAAATTTGAAAGAAATCGGGGCAGAAGAAGGCCTCCGTTTCCGGCAGACTGCCAATGGGGCGAAGCTGCTGGAGTGTCCCGGTGCCGACAGCTCTGGCATCGCAGAAAAACTAGTGGCGACGCTCCGCGTGGCGCTGCCGGAGGAAGAGGTGCGCGTGCACAGGCCGGTGAGGATGGCCGAGATTAGGATCACCGGCCTGGACGACTGCGCCACCAAAGAGGAGGTGGCAGCCGCGATAGCCGCCCAGGGTGGATGTGCTCCAGAGAGTGTGACCGTGGGTGAACTCCGCTCAGGGTACTCCGGGGCCAGGTCGGCGTGGGCGCGCTGTCCGGTTGAGGCGGCTACCTTCTTGGCCACTCCTCCACCGGGAAGATCGACGGGGGATCCAGGGAGACTGCGAGTGGGCTGGATAGCGGCCCACGTGCGTCTTCAAGAACCGCGGGCCTGGAGATGCCTGCGGTGCTTTAGCACTGGACACGGCCTCGCCAGGTGCACCAGCTCGGTTGACCGAAGTGGTCTCTGCTTCCGATGCGGCCAACCGGGTCATAAAGCGGCGTCCTGCACGGCCGCCCCGCACTGCGCTCTGTGCGCTGCAGCCGGGCGCGGGGCAAACCATCGGGCAGGAGGCAAAGCGTGCTTCCCGTCCGGTGATAATACCGAACGCAACCGGCGTCGCAAGGCAAAGCACCGGCAGAAGAGAAAGTTGGCCAGAGGAGCACTGGCCAACGTTGTAATCCCCGCTGCGGCGCCGGTGCCGGAGGGCGGGGGCAGCGGAAACCTGAATCACTCCGCCAGAGCTCAGGACATGCTGTCTCAGAGCATGGCGGAGTGGTCCATAGATGTGGCTGTGGTCGCCGAGCCGTACTTCGTTCCCCCGGCAAATGATTGCTGGTTCGGGGAAGATGACGGCCTGGCGGCCATAGTCATAAGAAGAGACGCGGCGATCCCCCCCCTGGCGATGGTGACCAGGGGCCAAGGGTTCGTCGCGGTGCAGTTGGAAGGGACCGTCGTGATCGGGGCGTACTTCTCTCCGAACAGGCCTACTGTCGAGTTCGGGCATTTCCTGGGCGGGATCGGGGCGATTGCTCGCCGCCTTGCTCCCCGCCCAGTGATTCTCGCGGGGGACCTCAATGCGAAGTCTGTCGCATGGGGCTCCCCCCGCTCGGACGCTCGTGGTAGGCTACTGGAGAGGTGGGCGAACGCGGCCGGCCTCTGTTTGTTGAATAGAGGTTCGGTTGCGACGTGCGTGCGGTGGCAGGGCGAGTCTATTGTGGACGTTACGTTCGCAAGCCCGGCCATCGCACGCCGTATCCGCGACTGGAGAGTTTTGGAGGGGGCGGAGACACTGTCAGATCACCGATATATTCGGTTTGATCTCTCCGCCCGCTCCGCAGTCGCGGACGTCCACGGGGACCACCCCCGTGGTGCGTCCCGGTCATTCCCCAAGTGGGCACTGAAGCGCCTGAACAAGGAGCTCCTGATGGAAGCCTCTACGGTGGCGGCGTGGGCGCCCATGCGTCCACACCCGGTCGAGGTCGAGGGAGAGGCAGGGTGGTTCCGGGACACGATGCGTCGCATCTGTGATGCGTCGATGCCCCGGATCGGCCCTCGACTTCCTAATCGCCAGGCGTACTGGTGGTCGCCCGAAATTGCGCAACTCCGCGTGGAGTGCGTTCGGGCGAGGCGCGAGTGCGCCAGGCATCGCCGCCGCCGCCTGCCGCGGCGCAACGATCCGGTTGCGTTCGCGGCGGCAGAGGCCCGGCTGCACGGTGCATTTCGCGTCGCGCAGAGGGCATTGCAGCTGGCCATCAGAAGAGCCAAGAACCAACACATGGAGGGTCTCTTGGAGACGCTGGATGAGGATCCGTGGGGGCGGCCCTATCATATGGTGCGCAATAAAATGCGCCCATGGGCCCCCCCGATCACGGAGCGTCTCCAGCCTCAGCAGCTGCGGGACATCGTCTCGGCGCTGTTCCCGCAGGAGCGGGAAGGATTTGTCGCTCCCGCTATGGACGCGCCGCCGGAATACGACGGCGAAGTCCCTGCTGAGGTGCCCCGCATAACGGGGGCGGAGCTCCGTGTGGCCGTGCGCAAAATGTGCGCGAAAGACACTGCACCCGGCCCGGATGGCATCCATGGCCGGGTTTGGGCCTTGGCTCTTGGTGCCCTAGGGGACCGACTCTTGAGGCTTTACAACTCCTGCCTCGAGTCGGGACGGTTTCCTTCATCGTGGAGGACGGGCAGACTCGTGCTGTTGAGAAAGGAAGGGCGCCCGGCGGATACTGCCGCTGGGTACCGTCCCATCGTGTTCCTGGATGAGGTGGGCAAGCTGCTGGAACGCATTCTGGCGACCCGCATCATTCAGCATCTGGTCAGGGTGGGACCCAATCTGTCGGCGGAGCAGTATGGCTTCCGAGAGGGCCGCTCAACAGTAGACGCGATCCTTCGCGTGCGGGCCCTCTCGGAGGAGGCCGTCTCCAGGGGTGGGGTGGCTTTGGCGGTGTCGCTCGACATCGCCAATGCGTTTAACACCCTGCCCTGGTCCGTGATAGGGGGGGCGCTGGAACGACATGGAGTGCCTCCCTACCTCCGCCGGCTGGTGGGTTCCTACTTGGAGGACAGATCGGTCACGTGTACCGGACACGGTGGGATCCTGCACCGATTCCCGGTCGTGCGCGGTGTTCCACAGGGGTCGGTGCTCGGCCCTCTTTTGTGGAATATCGGGTATGACTGGGTGCTAAGGGGTGCCCTCCTCCCGGGCCTGAGCGTAATCTGTTACGCAGACGACACGTTAGTCGTGGCCCGGGGGGGAGTTTTGCTGAGTCTGCCCGTCTTGCTACCGCTGGGGTGGCGCATGTCGTCGGCAAAATCAGGAGATTGGGCCTCGACGTGGCGCTCAGTAAATCCGAGGCCATGTGGTTCCACAGGCCCCGGAGAGTGCCACCTGTCGATGCCCATATCGTGGTTGGAGGCGTCCGTATCGGGGTCGGGGTGCAGTTGA
Protein
MRSTLASDSGAIIPTKPSAGKKRGQRKTPVVTSDDGGASSSSTEVPEKTMAIEDVAPVISGPAASKDTMPAPQRAPVRRRGAVSPATSVESMSTSVASLASGDETFRDLDLALVNLGKLLSTVAAKGAQPGSSYRKRLREGAAMVRTRLIPTMSKLYDLVASREAENKGLVAQLDSRESRIPGDSSASQGETSLSPVPTLACSGPSVEAKQYGCWDGGVDDCLPSREEIVACISRAVAVEVGKHFAGLEEMLRSSIRSGDCIPVPTAAVSPRDRAARPTSAPTPPARVVRRGGRNQNNRGVRDQNPDPRSQPQPRPLPPPPSSMDEGWTEVVRRGTQAWRQTAALAAPRGGRAPTAAARKTALAAVAAPREGRAPAAGKKKSKKKKPRAARSAAVVVTLLPAAAEKGLTYNNVMARARAAVNLKEIGAEEGLRFRQTANGAKLLECPGADSSGIAEKLVATLRVALPEEEVRVHRPVRMAEIRITGLDDCATKEEVAAAIAAQGGCAPESVTVGELRSGYSGARSAWARCPVEAATFLATPPPGRSTGDPGRLRVGWIAAHVRLQEPRAWRCLRCFSTGHGLARCTSSVDRSGLCFRCGQPGHKAASCTAAPHCALCAAAGRGANHRAGGKACFPSGDNTERNRRRKAKHRQKRKLARGALANVVIPAAAPVPEGGGSGNLNHSARAQDMLSQSMAEWSIDVAVVAEPYFVPPANDCWFGEDDGLAAIVIRRDAAIPPLAMVTRGQGFVAVQLEGTVVIGAYFSPNRPTVEFGHFLGGIGAIARRLAPRPVILAGDLNAKSVAWGSPRSDARGRLLERWANAAGLCLLNRGSVATCVRWQGESIVDVTFASPAIARRIRDWRVLEGAETLSDHRYIRFDLSARSAVADVHGDHPRGASRSFPKWALKRLNKELLMEASTVAAWAPMRPHPVEVEGEAGWFRDTMRRICDASMPRIGPRLPNRQAYWWSPEIAQLRVECVRARRECARHRRRRLPRRNDPVAFAAAEARLHGAFRVAQRALQLAIRRAKNQHMEGLLETLDEDPWGRPYHMVRNKMRPWAPPITERLQPQQLRDIVSALFPQEREGFVAPAMDAPPEYDGEVPAEVPRITGAELRVAVRKMCAKDTAPGPDGIHGRVWALALGALGDRLLRLYNSCLESGRFPSSWRTGRLVLLRKEGRPADTAAGYRPIVFLDEVGKLLERILATRIIQHLVRVGPNLSAEQYGFREGRSTVDAILRVRALSEEAVSRGGVALAVSLDIANAFNTLPWSVIGGALERHGVPPYLRRLVGSYLEDRSVTCTGHGGILHRFPVVRGVPQGSVLGPLLWNIGYDWVLRGALLPGLSVICYADDTLVVARGGVLLSLPVLLPLGWRMSSAKSGDWASTWRSVNPRPCGSTGPGECHLSMPISWLEASVSGSGCS

Summary

Uniprot
ProteinModelPortal
PDB
1WDU     E-value=4.37572e-11,     Score=169

Ontologies

Topology

Length:
1420
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.80033
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00046
outside
1  -  1420
 
 

Population Genetic Test Statistics

Pi
240.316699
Theta
152.910517
Tajima's D
4.177126
CLR
1.975708
CSRT
0.9994000299985
Interpretation
Possibly Balancing Selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号