SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03726
Annotation
PREDICTED:_uncharacterized_protein_LOC105842184_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 2.088
 

Sequence

CDS
ATGGATGATTTAAAGTTATATGCCAACAATAAGAACAGCCTCAAAGTTTTACTTGATAGCACAGAGATTTTTACTAGAGACATAGGAATGGAATTTGGCTTAAATAAATGCAATGTGCTTCATTTAACATCTGGAAGGAGAGCTGAGCACCAGAGCGAAGGTCACATACTGTTGAGTGGCTTAAACTTCGAACATTTGAAGGAAGACGAAAATTATAAATACTTAGGTATAGATGAAGCAGGCAAAATAGATCATAAAAGAATTCAGGATCAGGTGAAAAGAGAGTACTTCAAAAGAGTAAAATGCATCACTAACACACAACTTAGCGCGAGAAACCTCATAACGGCCATCAACACTTATGCCACACCAGTTCTTTTATACACGTTTGGAATAATAAACTACAAAAATAGTGACTTAAACAAAATAGATATAAAGACAAGGAAGATACTCACTTTGAATAAAGCCCAACAACAAAAAGCGGATATCGAAAGACTCTATTTACCCATAGAAGAAGGAGGCAGAGGACTTATAAATATAGAAATGTTACACAAAACTCAGATTATTAAATTTAGGCAATATTTAAACAATGAACAGGACCAAATCATAAAAGCAATAGTTAAACACGATAAACATAGAGATAAACATTCAATACACAAAGATGGTAAAAATAATGCAGTAAGAATAGAATTAACAGAAAACAGAAACTACACCGATACTGAAATTAAGAAAGCAGTAATAAAGACTGGCATCAGTAAATGGAAAGAGAAACCGCTACATGGACAATTCCGTAGGTCCGTTATAGAGAAGGGTAATATAGATCGAGAGTATTCGTTCCGCTGGCTTAAGAAACAAATCGTGTCCCCCACGTTAGAATCTTCAGTATTCGCTATACAAGATCAGGCAGTAATTACGAGACAAATAGAAAGAGATATTCTAAAGAAATCTGTCGATGGTAAATGTCGCCTATGCCTAGCAAAAGACGAGTCCATAGAGCATATAATCTCGGGATGTGAAAAACTGGCCGGCACTTACTATGTGAACAGACATAACAACATAGTAAAGTATATTTGGTGGGCAATAGGAAGAAAACACAATTTTGAATTAGACTCGCTATGGTGGAAGGTGAATTTGACTCAACCTCAGATAAAAGAAAACAGCTCCGCGAAGCTAATGTGGGAGATACCAGTGCAGACGGACGTTACAATAAAGCACAATAGACCAGATATAATATACATAGACAAGACAGAAAATAAAACCTACTTAATAGATGTAACTGTACCATCTGACTACAATATAGGACCAAAAGAACTGGAAAAACTTAGTAAATATCACCCCTTAAAAGTAGAACTAACACGACTCTGGAATACACACACAGAAACCATCCCCATAGTAATAGGCGCAACAGGCGTAGTGGCAAAAAGTATACATAGATACATAAACAAACTGGAAGCAAATATAAACATACACATAATACAAAAACAAGCAGCCATACACACGTGCACAATAATAAGTAAAGTTTTGGGTAATACAGTTTTCATAAATTCAAGGGAGTCCGAACCTCCTCTTCCCTGA
Protein
MDDLKLYANNKNSLKVLLDSTEIFTRDIGMEFGLNKCNVLHLTSGRRAEHQSEGHILLSGLNFEHLKEDENYKYLGIDEAGKIDHKRIQDQVKREYFKRVKCITNTQLSARNLITAINTYATPVLLYTFGIINYKNSDLNKIDIKTRKILTLNKAQQQKADIERLYLPIEEGGRGLINIEMLHKTQIIKFRQYLNNEQDQIIKAIVKHDKHRDKHSIHKDGKNNAVRIELTENRNYTDTEIKKAVIKTGISKWKEKPLHGQFRRSVIEKGNIDREYSFRWLKKQIVSPTLESSVFAIQDQAVITRQIERDILKKSVDGKCRLCLAKDESIEHIISGCEKLAGTYYVNRHNNIVKYIWWAIGRKHNFELDSLWWKVNLTQPQIKENSSAKLMWEIPVQTDVTIKHNRPDIIYIDKTENKTYLIDVTVPSDYNIGPKELEKLSKYHPLKVELTRLWNTHTETIPIVIGATGVVAKSIHRYINKLEANINIHIIQKQAAIHTCTIISKVLGNTVFINSRESEPPLP

Summary

Pfam
PF00078   RVT_1
Interpro
IPR000477   RT_dom        + More
IPR001611   Leu-rich_rpt       
IPR012337   RNaseH-like_sf       
SUPFAM
SSF53098   SSF53098       

Ontologies

Topology

Length:
523
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
8.66320999999999
Exp number, first 60 AAs:
0.00123
Total prob of N-in:
0.38427
outside
1  -  523
 
 

Population Genetic Test Statistics

Pi
253.825788
Theta
164.052245
Tajima's D
1.360075
CLR
60.429592
CSRT
0.751712414379281
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号