SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03716
Pre Gene Modal
BGIBMGA010315
Annotation
Gag-like_protein_[Operophtera_brumata]
Location in the cell
Nuclear   Reliability : 1.881
 

Sequence

CDS
ATGGCCCGACGCGCACGCGAGCGACGCGCTACTCTAGCGGCGGAAGGGGGGGAACCATCTGCGGTGGCCCTAAGTCAGCTTGCCTTGGACGGGGTGGACTTAGTCCTGAAGGTTGCCACCAAATCCGGCAGCCTGAAGGGCACGTTTACCCGCGGTCTGAAAGAAGCTGCCGCGGACATTAAGGAGGCGATTGGCATCCTCCTCAACAGGACGGCCTCTGACGAGGTTGCGAAGTTGCAGGAGGAAAACAGCCGTCTCCGAAATGATATGGAGGACCTCCGGCGACGAGTCACTGCGTTGAGCGAGCAGCAGCAGCGGCGTACGTCCACTGATGCCGCATCGGTAGTGACCCCGGCTCCCGCACCGAGACCGACAAGCACTCATACCGACGACGAGGTCGAGCGCATTGTCCGGCTCTGTATGCTCCAGTGCGGGAGCATGGTCAATGCTCGTATGGAGGCAATTTCTCGGCGCCTCCCTGCGGAAATCCTCCGTCCGCCACTAGCGGCCGATACACGGCGGAGGGCTGAGGAGCCGCCGAGACCTAAGCCTAGGGAGGGGAAGCCCGCGGAGGGTGTCAAAAAGCCCGTCGAGGGAGCCCCATCGAGCGATCAGCCCACGACTGCTGGGTCTAAGGGTGAGACCTGGGTTACAGTCGTGGGCCGCAAGAAGGCACGCAGGGTCGCCAAGGCGGCCTCAGCAGCAACGCATGCGCCCGGCCAAACCGCAAAGGCGGTTGCGCAGCCTGCGCGGCGGGCTGCCAAAGGCGGTCGCAAAGGACCGGAGATACGTGCTCCGCGTTCCGAAGCTGTGACGCTCACGCTACAGCCCGGAGCTGCGGAGCGCGGCGTAACGTACCAGTCGGTCATCGCCGAAGCAAAGGCCAAGATCAAATTATCAGATCTTGGTCTTCAGGCCGTCACCCACAGGCAGGCTGCCACGGGTGCACGGTTGTTCGAGGTGGCTGGTACTACGAGTGGCAGTGCCGAAAAGGCGGACGCTCTGGCCGCCAAGATGAGGGAGGTCCTCAGCCCCGAGGACGTCCGGGTCTCCAGGCCAATGAAAACCGCAGAGGTGCGGATTGCTGGACTGGATGACTCCGTGACCTCTGAGGAGGTGGTAGCGGCCGTTGCCCGAAGTGGAGAGTGTCCATCGGACAAGGTGCGGGCCGGCGATATACGCACCGATGCCACCGGACTCGGCGTGGTCTGGGTTCGGTGCCCTGTAGCGTCGGCGAAAAAGATCGCCTTAAGCGGCAGATTGCTGTAG
Protein
MARRARERRATLAAEGGEPSAVALSQLALDGVDLVLKVATKSGSLKGTFTRGLKEAAADIKEAIGILLNRTASDEVAKLQEENSRLRNDMEDLRRRVTALSEQQQRRTSTDAASVVTPAPAPRPTSTHTDDEVERIVRLCMLQCGSMVNARMEAISRRLPAEILRPPLAADTRRRAEEPPRPKPREGKPAEGVKKPVEGAPSSDQPTTAGSKGETWVTVVGRKKARRVAKAASAATHAPGQTAKAVAQPARRAAKGGRKGPEIRAPRSEAVTLTLQPGAAERGVTYQSVIAEAKAKIKLSDLGLQAVTHRQAATGARLFEVAGTTSGSAEKADALAAKMREVLSPEDVRVSRPMKTAEVRIAGLDDSVTSEEVVAAVARSGECPSDKVRAGDIRTDATGLGVVWVRCPVASAKKIALSGRLL

Summary

Pfam
PF00098   zf-CCHC
Interpro
IPR036875   Znf_CCHC_sf        + More
IPR001878   Znf_CCHC       
SUPFAM
SSF57756   SSF57756       

Ontologies

Topology

Length:
422
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01387
Exp number, first 60 AAs:
0.00822
Total prob of N-in:
0.09098
outside
1  -  422
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
147.690678
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号