SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03711
Annotation
PREDICTED:_uncharacterized_protein_LOC105842708_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 1.058 Nuclear   Reliability : 1.34
 

Sequence

CDS
ATGGCGTCATTACAAGAAAGTCAAATGGCAGCATTCGAACGCCTACTCGACCGAGTTTTTGAGCATAAAACTCAACTCGAATCATCAGCAACACCGACGTCGGAGCCGACATCGCCGCCTTCCTCGACGCCCGCTCACCATTCTGGGAACTTCGCGTCATGCACGGCGCGGTTCAGCGGAGCGCCCGGCGACTCACTCGACGGTTTCCTTGACGCGGTCGAATCATACAAAGATTGTGCTGACGTAGGACACGCCATCGCGTTACGAGGACTCTCGATGTTACTAACCGGAAATGCAGCCGTGTGGTGGCAAGGCGTTAAAGCTAGCATCACTTCCTGGGACGACGCTTTATCATCGTTACGAAGCGCTTTCGGTGATTGCAGACCGCCCCATCGAGTCTACTTAGAGCTCTTCAAAATGTCGCAAGGACAAAGAGAGAAGACGGAGATCTTCGTTGCCAGAGCACGAGCCCTGCTAGCTCGACTCCCACCTGGTGACCTTAGTGAGAAAGTTCAAATTGATATGCTTTACGGCCTTCTACACCGTCGTGTTCGTAAAAGATTAAGAAGAGACGAAATAACTTCATACGACACGTTATTAAAGAAAACGCGCCATATCGAGGACTCCATCTACGAGACCAGTCCGCCTGAATTTATTCATCATCCTCAGCGAGCGACGCCACATGCTCAAAATAATGAAACTTTGCTTGGCATGGATTTTTTGGTGGCGGCAGGTATTGTGCTTGACTTTGCTTCATCCACTTGGCATTTTTCGGGAAAACGGGTTACCTATCCAATTGAATATGAGTGCCCTAAGCCATGCATGTTTGCTTCTACTGCTGACTTCCTGCGTGATGATAAGGGTTCTATGCTTGGCTCCGATGAACGGCAGCAGCTATCACATTTATTGCAGGAGAATGGAGACATCTTTAGGGTGGGGGGAGCCCCAACCCTTTACACCGAGCACCACATTGATACCGGTGATCATCCGCCTATATCGGTACCGCCGTATAGGCTCACTCCTGTGCTTCAACAGCGAGGAGAGGTTCTCGCAATCGATTTGTTCGGGCCACTGCCAGAAGGAGAGCAGGGGGAGCGATGGGTACTCCTGGTAGAGGATGTAGCTACAAGATGGGTGGAACTCTACGCACTTGTTGATGCCACCGCCGTGGCTTGCTCCCGAGTCCTACTGGAAGAGTATTTCCTTCGTTATGGCTTGCTTATGCGTCTAGGGGTGTAA
Protein
MASLQESQMAAFERLLDRVFEHKTQLESSATPTSEPTSPPSSTPAHHSGNFASCTARFSGAPGDSLDGFLDAVESYKDCADVGHAIALRGLSMLLTGNAAVWWQGVKASITSWDDALSSLRSAFGDCRPPHRVYLELFKMSQGQREKTEIFVARARALLARLPPGDLSEKVQIDMLYGLLHRRVRKRLRRDEITSYDTLLKKTRHIEDSIYETSPPEFIHHPQRATPHAQNNETLLGMDFLVAAGIVLDFASSTWHFSGKRVTYPIEYECPKPCMFASTADFLRDDKGSMLGSDERQQLSHLLQENGDIFRVGGAPTLYTEHHIDTGDHPPISVPPYRLTPVLQQRGEVLAIDLFGPLPEGEQGERWVLLVEDVATRWVELYALVDATAVACSRVLLEEYFLRYGLLMRLGV

Summary

ProteinModelPortal

Ontologies

Topology

Length:
412
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.30292
Exp number, first 60 AAs:
0
Total prob of N-in:
0.01450
outside
1  -  412
 
 

Population Genetic Test Statistics

Pi
4.628668
Theta
17.890809
Tajima's D
-1.66573
CLR
39.142959
CSRT
0.0414479276036198
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号