SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03702
Annotation
PREDICTED:_uncharacterized_protein_LOC101738890_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.918
 

Sequence

CDS
ATGAAATCCCTAGGAATGATAGATGCAACATTTGATTCGTTAAAACACCAGTTCCACCTTGTCTCTGACTTGGATTTTCCATATGACGGCATAATAGGTAATGACTACTTCACCACACTTAACTGCAAAATAGATTACACTGAAAATACATTAGTTGTCAACAACACTAAACTTAATCTAAAATTCACTGATCCAATTTATACTATTCCTCCTAGGACCGAAACCGTTATCGAATGCTCTGTACTAAATCCAGAAGTTAAAGAGGGTCTTATTTTAGACCAAAATCAGATCAGTTCTCTTCTCATCGCTAACTGCATAGTAAAAGTTAAATCAAACTCAAGAATAAATATATCAGTTGTGAATACTTCCGAATATCCATTACGTGTAAATTCAAACTTAAAACTCAAATTGATACCATTTGACGAAAAAGCTAATAGCAAAATTTTCTATACTTCCGTCAGTGACAAAGAAAGTCAAAACAATGCTTTAGAGAGAGCCGAAGCAGTTCTAGACCTATTACGTGTCTCACATTTGAATGTCGAAGAAAAAGATGCTCTCTATGATCTATGTGCGACTTATTCTGACATCTTCCATTTACCCAATGACAAATTGACTTGTACCGACGCGATACTTCATGAAATAACCACTTCTTCCTCTGTCCCTATTAATACGAAATCGTATAGATTCCCTGAAGTGCACAAACAAGAAGTCCAATCCCAAATTACTAAAATGTTGGATGAAGGGATCATTAAACCTTCCACATCTCCATGGTCCTCTCCAATCTGGATAGTCCCCAAGAAAATCGACGCATCTGGTCAACGCAAATGGCGAGTGGTGATCGACTACCGTAAGCTCAACGACATCACTATAGGTGACGTTTATCCAATCCCTAATATTTCCGAAATATTGGACCAACTAGGTAAATCTAAATATTTCAGCACATTAGACCTTGCTTCCGGTTTCCATCAAATTAGGATGTCTCCACAAGATGCTCCTAAAACCGCTTTCTCAATTCCTCAAGGTCACTTCGAATTCACACGCATGCCTTTCGGACTGAAAAACGCCCCAGCTACTTTTCAGAGACTCATGAACTCTGCCCTCTCAGGCCTACAAGGCATACAATGCTTCGTATATTTGGACGATATAGTCGTCCATTCATTTGACCTAGAAAAACATATCCTCAACCTTTCCAATATTTTCGACAGGCTCCGTACTTTTAATTTAAAACTTCAACCCGACAAATGTGAATTTCTCCGTAAGGAAGTATCTTACCTTGGTCACATAATAACCGATGAAGGTGTAAAACCCAATCCGGAAAAAATCAAAGCCGTGCAACAATTTCCTACTCCCAAATCTCCCAAAGATATAAAATCCTTCCTTGGACTCGTATCATACTACAGAAAATTTATCCCAGATATATCCAAAATAGCTAAACCCCTTACTAATCTCCTAAAAAAAAATGTCCCGTTCCTTTGGCAAAATGAACAGCAACTCGCCTTTGAAACCTTGAAAAACGCACTCATAACAGCTCCACTACTAGCCTATCCTGACTTTAACAAACCATTTGTACTTACTTGTGACGCATCCGATTATGCAATCTCCGCCATTTTATCCCAGGGTGAAATAGGGAAGGATCGCCCCATTGCCTATGCATCACGAACCCTAAACAAATCCGAATTAAATTATTCCGTTTCTGAAAAAGAATGTTTGGCCATTATATTCGGCACCAAAACGTTCAGACCATATCTATATGGACATCGTTTCAAAATTGTTACAGACCATCAACCGCTTAAATGGTTATTCAGTCACAAAGATCCGTCTTCCAAATTAATCCGATGGAGACTCAAACTAGAGGAGTTTGATTATGAAATTGAATATAAAAGGGGCAAAATCAATCGAAACGCGGATGCTTTGTCCCGTTTTCCTGTAAACCCAATAATCGAAAACCAACCTCAATCTTCCACTTCTGGCACCGCCAACCCTAATCTCCAAGAATCTGAGATTCCTTCCGACCTTCTAGAAGACCTTACCGAACTTGGTGCCTTAGATATCAGTCCAAGCCAGGGCGTCGACTTCAGCCCTCTCTATCCACCTTCCGAATCAAGTGATCCAAACCCTCCACCTTTGCCAGATCCTGTCAACGACACACACGAACCGACACCTGAAATAAATTCCAACATCACAGACGACTACTCGACCTTTCTAAAATCCTTCACAGACGAGAACCAAACTTTTAATACTCAAGTTAAAGAACACAACGAAAGTCTCCTTAAAAGCACTTCAAAAACTATTTTAATCCCTGTCTCCATTGATTTCGATGACTCAAACCCTTATCTTGAAGACATACTTTCCTCATTAGAAGACCGTACAATCCTTGACAATGAACGTGAACTTCATAGTTTTATGAAAATAGAGCTTAAAGGAAAAGTTTTTTATCTTCTATTTACGAAGGTTTACTATTTCGACAATTGCACTTACCCAGACATATTCAAGACCCTTAAGTCCGCACGAGACGACATCATACTCCAAGGTGACATAAATGATATTGCCATTTCCGACTTCAAGAGCTCATTTGAACAACACTCTTTTGTGAAAATTTATGGGATGCTAGTTTACCTATTCAACAACACAAACACTACAGTAAACATACACCATGATACTATCATCCATCCTGTCCCTACCGAAATTTCTAGAATACTGAAAGAAAACCACGATATTCCGATCGCCGGTCATCTCGGTTCCAATCGAATGTTAAGCAGAATTAAAGAACGTTATCATTGGAGAAATATGCGCTCAGACATCGAAGACTACGTCAAGAATTGCAAACTGTGTCAATCAAACAAAGCTCTGCGCAAGATCAACAAATCTCCTATGCAAATCACCACTAGCTCTACTCGCCCCTTTGAGAGGATTAGCCTCGATCTCGTTGGTCCCTTGCCTGAGGCTGGCCTTTCAAAGCTTAAGTTTATTCTAACTCTTCAAGACGATTTAACCAAATTTTCTATTGCATACCCAATCTCTAATGCTACCGCAGAGGAGTCCTGCGAATGCTTAGTCCACTTCATTTCCTTATTTGGTATCCCGAAATCAATACTCACTGATCAGGGAACCAACTTCACTGCCGAACTCTTTAAAGTAACGTGTCAATTTTTAAAAATTAAGCAACTCTGGTCCTCTCCCTACCATCCCCAAACGCAGGGCGCCCTGGAAAGAAGTCACTCAACACTAAAAGAATACCTTAAGTCTTATGTGAATGATAATCAGACAAACTGGCATAAATTTGTATACACAGCTATGCTCACCTACAACAGTACAATCCACACCACTACTCAATTCACACCTTACGAACTCGTCTTTGGTCATAAACCATATATACCCGACTCCGTCTTCGATTTACGATCAGATGTCACGTACCCAGAATATCTTAAGATGCTTAGTCACCGCCTCAAAATATCAAGAGAAAAAGCTCTACAAAATATTAATGTCTCTAAAGAAAAGTCCAAGACATATTATGACAGACACTCTCGCCCCGTCCAATACAAAGTTGGAGATTACGTGTATTTAAAGAATCATCTCCGACTTAGAAAGGCCCTATCACCGATGTGGAAAGGTCCTTACAAAGTTGTAAAAATTCACGGCAATAACACCCTTTCCCTCCTGATAAATCGTCGGCACGTGAAACATCATTTCGACGAAGTAAAACCAGCACCCGTAGTATAA
Protein
MKSLGMIDATFDSLKHQFHLVSDLDFPYDGIIGNDYFTTLNCKIDYTENTLVVNNTKLNLKFTDPIYTIPPRTETVIECSVLNPEVKEGLILDQNQISSLLIANCIVKVKSNSRINISVVNTSEYPLRVNSNLKLKLIPFDEKANSKIFYTSVSDKESQNNALERAEAVLDLLRVSHLNVEEKDALYDLCATYSDIFHLPNDKLTCTDAILHEITTSSSVPINTKSYRFPEVHKQEVQSQITKMLDEGIIKPSTSPWSSPIWIVPKKIDASGQRKWRVVIDYRKLNDITIGDVYPIPNISEILDQLGKSKYFSTLDLASGFHQIRMSPQDAPKTAFSIPQGHFEFTRMPFGLKNAPATFQRLMNSALSGLQGIQCFVYLDDIVVHSFDLEKHILNLSNIFDRLRTFNLKLQPDKCEFLRKEVSYLGHIITDEGVKPNPEKIKAVQQFPTPKSPKDIKSFLGLVSYYRKFIPDISKIAKPLTNLLKKNVPFLWQNEQQLAFETLKNALITAPLLAYPDFNKPFVLTCDASDYAISAILSQGEIGKDRPIAYASRTLNKSELNYSVSEKECLAIIFGTKTFRPYLYGHRFKIVTDHQPLKWLFSHKDPSSKLIRWRLKLEEFDYEIEYKRGKINRNADALSRFPVNPIIENQPQSSTSGTANPNLQESEIPSDLLEDLTELGALDISPSQGVDFSPLYPPSESSDPNPPPLPDPVNDTHEPTPEINSNITDDYSTFLKSFTDENQTFNTQVKEHNESLLKSTSKTILIPVSIDFDDSNPYLEDILSSLEDRTILDNERELHSFMKIELKGKVFYLLFTKVYYFDNCTYPDIFKTLKSARDDIILQGDINDIAISDFKSSFEQHSFVKIYGMLVYLFNNTNTTVNIHHDTIIHPVPTEISRILKENHDIPIAGHLGSNRMLSRIKERYHWRNMRSDIEDYVKNCKLCQSNKALRKINKSPMQITTSSTRPFERISLDLVGPLPEAGLSKLKFILTLQDDLTKFSIAYPISNATAEESCECLVHFISLFGIPKSILTDQGTNFTAELFKVTCQFLKIKQLWSSPYHPQTQGALERSHSTLKEYLKSYVNDNQTNWHKFVYTAMLTYNSTIHTTTQFTPYELVFGHKPYIPDSVFDLRSDVTYPEYLKMLSHRLKISREKALQNINVSKEKSKTYYDRHSRPVQYKVGDYVYLKNHLRLRKALSPMWKGPYKVVKIHGNNTLSLLINRRHVKHHFDEVKPAPVV

Summary

Pfam
PF00665   rve        + More
PF00078   RVT_1
PF17919   RT_RNaseH_2
PF17921   Integrase_H2C2
PF17917   RT_RNaseH
PF12259   Baculo_F
Interpro
IPR021109   Peptidase_aspartic_dom_sf        + More
IPR000477   RT_dom       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR001584   Integrase_cat-core       
IPR041577   RT_RNaseH_2       
IPR012337   RNaseH-like_sf       
IPR002589   Macro_dom       
IPR041373   RT_RNaseH       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR022048   Envelope_fusion-like       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF57756   SSF57756       
Gene 3D
PDB
4OL8     E-value=9.43281e-68,     Score=657

Ontologies

Topology

Length:
1239
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0012
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00002
outside
1  -  1239
 
 

Population Genetic Test Statistics

Pi
3.607022
Theta
3.933856
Tajima's D
-0.22162
CLR
41.004809
CSRT
0.327233638318084
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号