SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03693
Pre Gene Modal
BGIBMGA005561
Annotation
PREDICTED:_uncharacterized_protein_LOC101742325_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.779
 

Sequence

CDS
ATGCAGAACATTGCCAACAACAATGCCGCCGCTTATATCGTGAGCGAGAACGAGGAGAGAAACAGGATCAGTCGCGAGTCCGTGGTGGAGTTCGAGCCGCTCCCCACAGAGCTGAGGGTCGCCGATCCCCTGGAGCGATGCGCGGACTGGTTCAGCGGGGAGGATTTCCCGAGGAATCAATTGCAGTACCTTCGGGAGATAGGACGTGGATGGTTCGGCAGAGTGGTGGAAGGTGAGGTCGACGATGCTGGTCCAACGAAAGCAGTGGCCGTGAAGATACTCAACCCGAATGCTAATCTAGAAGACAAGGCCAGGTTCTTAGACGAAGCCAAGTTGTACCGGGATTCGCGACACGATACCATCCTCGGCTACGTCGCTAGGTGTCTGCAGGAAGACCCGTGGATTGTCATATTCGAATTGTGCAGTACGGATCTCCAGCAATACCTAACAGTGAACAGACCGAAGATGGCGATACTGAACGAGAGCGGGGTTCCGTTGCGGTTGATGTGTGACGTCACTTCCGGACTCTCCTATCTCAATTCCAGGGGACATTTGTACGGGAATCTATGGAGCGGTAACGTGCTAGTACGCGGCGAGGCGGACAACGCGCGGGCCGTGCTGGGACGGTACACGAATGCCGAATGTCCGTACGAACACGACGCTCCCGAGACGAGGAGACACCCGCCTCTGTACACGGCCAGCAGTGAAGTATGGTTCCTAGGAAATCTGATATGGGAGGTCTGCGCCTGGGGAGCAACACCCGTCGCTCTACCGCCGCCGCTACCTGACCTTCCCTGCCCGTACAGAAATCATCTATATCAAGTGATGCAGCTGTGCTGGAACACCAATCCGGATGCTCGTCCTACTTCCGCCCAGGTTCACGGTCTCATCGATCACTTGTACACAAGTCACACGGAGACTACAGAGTTGTCGCAAGACGGGAGCTTCGGGACCAGCGACTTCGAGGAACGCTGGCAACGACTCAAACCCAACACGATACCGAAGATAGACGAGCACGTCGCCATCGTGCACGCTCCCTCCACCTCCGTCGCCTCGCACTTCACCGGCTCCGACCGCGAGCTCGACGACGCGCACACCGCACACGACACGCTCAGCATCGACATGGACACCGCCGTCTCCAGATCCAGCAGTATCATGTCGGACAAGGATCCCTTGTCCATACAGATCAAGTCCGAGAGTCTCACCAACCTCCACGGATCGCTGGAAGACGTCAGGAACATCTACCTCACGCACAACGAGATGGCCGCCCTCGAATGCCATCAAGGAAATATGCAACTTGACGAAGGCAGGGAAAAAGAAAACGATAAATCCGATAGTTCAGTTGATCCCTGGGTGAAGGACATCATGGCGGGGAGCCAGGACGACGTCAGCTACTTTAAAGACGTCAGCGACGTCATTAAGAATCTCGATAATATGCTGAATTCTGAAAAAACTTCAAGCTCTGAATCCAGTCATCAGGCTAGTCCTTCAAGGGACAATTTGAGTTTGGACTGTAAAAAAGAGTATCCGGTACAGTCTAGTTTAGTCAAATCACCCGGTATCAATAATTTCCAGAATATTCTAGACGCTGGTTTCGATACTAATCAAGACGAGACAGAAGACGAAGATGTCGACCGTGATACAATCGGGACGTTGAGTCACTCATTCGAAAGGCACAGTGACACTATCAGTCAACAAACGTTAGAAAATCTCACTCCAGAAACACCTATAAAAGATTTAGTTGGTACTGGAATTTCTGGACTAAATGTTCCTCTTGATCTTGATGAAGTAGCGCACGACGAGGTAGATGTGCGAAATGTATTGCCAAATGATAAAGTAGCTAATAGTGATAGTGAGATACCTAAATTGAAGGAATTGTGCGCGTCCTCTATATCTAGTGTAAGTGAAAATATACAGCATGTTAGAAGTGAAGACTGCCAGTTTAAGTGTGATAGTAATGTAAACAAAGAAATTGATGATAAGGAAGGAACTAAGTCATTAGATGATAACCTACTATCTAGTGAAGAGGCTGGAGAGTTTATTGAAGAGAAAAATGATATTATATTAGACAGTGTAGATAAAAATGTCTTGCCTAATTTACATACAAATAATAAACATGAACTTATATGTGAAAATTCAGGGCTTGAAAGAGAAGACTCAAAAAATGAATCAAGCAGTAGTTATAATAAACAAAACGTAGAATTTAGTGATCTCATTGAAAACGTAATTGATAATTTAGTAGAATCACATGTTGTTAAAAGTGATCCTAACACTACATACATATAG
Protein
MQNIANNNAAAYIVSENEERNRISRESVVEFEPLPTELRVADPLERCADWFSGEDFPRNQLQYLREIGRGWFGRVVEGEVDDAGPTKAVAVKILNPNANLEDKARFLDEAKLYRDSRHDTILGYVARCLQEDPWIVIFELCSTDLQQYLTVNRPKMAILNESGVPLRLMCDVTSGLSYLNSRGHLYGNLWSGNVLVRGEADNARAVLGRYTNAECPYEHDAPETRRHPPLYTASSEVWFLGNLIWEVCAWGATPVALPPPLPDLPCPYRNHLYQVMQLCWNTNPDARPTSAQVHGLIDHLYTSHTETTELSQDGSFGTSDFEERWQRLKPNTIPKIDEHVAIVHAPSTSVASHFTGSDRELDDAHTAHDTLSIDMDTAVSRSSSIMSDKDPLSIQIKSESLTNLHGSLEDVRNIYLTHNEMAALECHQGNMQLDEGREKENDKSDSSVDPWVKDIMAGSQDDVSYFKDVSDVIKNLDNMLNSEKTSSSESSHQASPSRDNLSLDCKKEYPVQSSLVKSPGINNFQNILDAGFDTNQDETEDEDVDRDTIGTLSHSFERHSDTISQQTLENLTPETPIKDLVGTGISGLNVPLDLDEVAHDEVDVRNVLPNDKVANSDSEIPKLKELCASSISSVSENIQHVRSEDCQFKCDSNVNKEIDDKEGTKSLDDNLLSSEEAGEFIEEKNDIILDSVDKNVLPNLHTNNKHELICENSGLEREDSKNESSSSYNKQNVEFSDLIENVIDNLVESHVVKSDPNTTYI

Summary

Pfam
PF07714   Pkinase_Tyr
Interpro
IPR000719   Prot_kinase_dom        + More
IPR011009   Kinase-like_dom_sf       
IPR001245   Ser-Thr/Tyr_kinase_cat_dom       
IPR017441   Protein_kinase_ATP_BS       
SUPFAM
SSF56112   SSF56112       

Ontologies

Topology

Length:
761
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.04157
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00234
outside
1  -  761
 
 

Population Genetic Test Statistics

Pi
35.58746
Theta
50.469856
Tajima's D
-0.86297
CLR
21.192155
CSRT
0.165991700414979
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号