SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03672
Annotation
PREDICTED:_uncharacterized_protein_LOC103314804_[Tribolium_castaneum]
Location in the cell
Nuclear   Reliability : 2.029 PlasmaMembrane   Reliability : 1.849
 

Sequence

CDS
ATGCCGCCTAAATCTAATAAATCCGAGAACGATTTGAAGCTTTTGTACGCTAAGAGGGATATGATTTATTCACGCGTGCAAACAATTTGTGATAATGCACTTAAGATATCCGACTTAGCAATACGAGACTCATTTCTTTGTTCTATTGAAAACATAGACGATTTGCGCGCGGATTTCGAAAGTATCGTTCATAATATCAACGCATTGCAATTAGAACTAGATCCTGATTACGCCGTCAGTTACTCTGTTATGTCGTCGTTTGATGATCTATATTGCCGTATAAAACGTGTCGCTAAATCTTTAGGAAAAATACCTAGCGCCGGGTATTCGCAAACGGAACCTAAGTTCACCCGCGATAGACCTAGACTACCGCCTATCCACATACCCGAATTTAATGGGGACATCCGTAATTGGGGTTTATTTATAGATAGTTTTGAAAATACAGTAAATCAAAATGATCACTTAACCGATCACGAAAAATTACACTACTTAGTAGAAAAACTTACCGGCAAAGCCCGTGCGGCTTGCGCGGGAATTACGTTTAGTGCCGAAAACTATTCTTTGATTTTGAACACACTCAAAGCCAAATATGAAGATAAACGGTTGATAGCTACCGCGTACCTGGATCAGTTGTTCGAATTAAAACCTATTTTATCGTGTACCGAACAGAATTTGGAGAAATTCTTAGACATATTTGCATCATCTGTTCGGGCTATTAGAAATCTCAACGTCAATGACCTCAGCGACTTTTTATTTTTGTACATTGGCTTAAAAAAGTTAGATTTCGAAACTGTTCGCTTATTTGAAACGAATCAGGGTACTAAGGGTATTGAATTGCCGAAATTTAATGAATTGGAATCATTTTTACGTAATCACATAAGAATACTTCAGCGTACTACGCGACCTCACGAGGTCCCGAAAAGACAACCAGAAAGGCATTTAGAAACGTCTTCAAGACCGCTTAGAACGACTCATAGCTATGTAAATACCGCGGCGTTGCCTGCGTCCGTGCCCGCCAAGTCGACTTGTTTTCTGTGCAAATCTTATCATACACAGTTGTATCAGTGTGCTGAGTTTTTGAAATTGTCGCCTAAAAATCGTTATGATTTTGTTCGCACAAATAACTTGTGTTTAAACTGCCTTAGTGATAAACATCGCGTTGGTGTGTGTAATAGTAGCCATAGTTGTCGCAAATGTTCGTTGAAGCATCATACCTTGCTTCATTTTGATAAAAATAATAATATAGTAGCCAATAGAACTACAAGCGCAGGTAATCAACCAATGTATGGTAACTCGTCGCTAGCAGTATCAAGCTCGGAGCACTCGCATGGTCGAACTCACGCTGGCGGCACCGCACGTTGTACGACACATCTCGCGCGTCCGACGTATTCACCCGCGCTTCCCGCCGCTGCTGTCGCTGCCGCTCGCACAGACAGCTCCGCAGCTATCAACTCGGACGGCAACACAAATGACGTCACATTATGCTCGCTGTCTTCCGCTCGCTTACCTACAACTGTTTTGCTTGCGACCGCTCGAGTTGTAATGGTTGATACTTATGGCAAACCGCATCTTGTTCGCGCCCTTTTAGATAGCGCCTCACAGAGTAATTTTATTACTCGTGAATGTTGTCAACGCCTTGGATTAAAATATAGTAACCAGCCTACGTGCCCCGTAGTCAAGGGCATAGGGGGGTCTACTAAGGACATCCAAGGGTCCGTAAAAATTAAATTTGAATCACGTTTTAGCTCGAATGTTTCATTCGAAATAAACTCGCTGGTTGTAGATAAAGTAACGGAGCAACTTCCTACTGTTTCTGTAGATACCTCGTTGTTAGCTAACTTTGATAGTTTGCCGTTAGCCGATGATACTTACGCCGTTCCAGGAGCCGTCGATATTTTGATTGGCGCTTCGATTTTCCCGCACCTCCTGCTGCCACGTAAGGTTCAAGGTCATTCGGCGAACCCCGCACCGCACGCTTTGGAAACTGTTCTCGGTTTTGTTATAGTTGGATCCGCACCCGCTCTTATAAATAGTTACTCGACCGTATCATACTGCTGCGCCGTCGAGCCGCCACTGGACTCCACCGTCCGCCGCTTTTGGGAAATTGAAGAAGTAAATGTTCCGCTGGTTATGAGTCCTGATGATAAGACCGCTGAGGATATTTATTGTAGCACGACCACCCGCGATGAAAGTGGTCGTTATATTGTTGCACTCCCGTTTAAGGGTGATACCTTTTCGCTTGGTGATTCGCGCCTAATGGCCGAAAAACGCTTTTTTTGTTTAGAACGTAAGATGATGGCATCTCCGAAGTTGAAAAAGGCCTACGACGATGTCGTGAATGAATATGTAGATAAGGGTATCATCTCACCTGCTCCCGCTGTACTTGATGAGACGCAAAATGGTCCCTCTTATGTCATCCCGCATCATGGTGTCATTAGGGAGGATAAACTCACCACAAAATTGCGTGTTGTTCTGGATGGCAGTGCTAAGACTAGTACTTCTGTTTCTCTAAACGACATCTTGTATTGTGGTAAAAATCTTCAAGGTAACTTGTTTGATATTATCGTCAATTTTCGTTTATTTATTGTAGCGCTATCTGCAGACATTAGACAAATGTTTCTTTGTATTGGCATTCGGGAATCGGATCGTAGATTCCAAAGATTTTTATATAGGTTTTCCCCACACGAACCATTAAAGGTTTACCAGTTTAACCGCGTTTGTTTCGGACTTAAGTCAAGTCCGTTTCACGCGCTTCGCACTGTGAAGCAGTTAGTTCTTGATGAGGGTGATTCCTACCCCAAGGCAAAAGCTACCATCAATACTGGTCTGTATATGGATGACTTTGCTTATAGTGTAGATAGCGAGCCTGAAGCCATCGAAACAGCTACTCAAGTGATAAGCCTAATGAAGACTGGGCAATTTGACCTTGTTAAGTGGACGAGCAACTCTCAACGTGTTTTGGACTGGATTCCGCCATCGCATCGTCTATCGACGGTTAAGGATTTTGATGTCAATGATACACATAAGATTCTCGGCTTGAGCTGGTCTCCCACATCCGATACATTCAGTCTCAAAATTAGCTCGACCCCGCCAACTTGTACCAAACGCACCATATTGTCTTGTGTCGCTCGCATATGGGACATTATGGGTTTTGTAGCACCTGTAGTGTTATACGCAAAGCTTCTTATTAAAGAGCTTTGGCTTTCTCAGTGTGACTGGGATGACATCGCACCGGACAACGTGGCCAGATTATGGGCTCGCTTCAGGGAAGAGCTTCCTATGCTCGAACATATAGAAATCCCACGTCATGTAGGTATCTCTCGAGATAGTGTAGTCACAATAGTGGGGTTCGCAGATGCTAGTGAGAAGGCTTATGGAGGAGTGGTGTATTTTCACGTTTGCAATGGCGACAATATTACAGTTAGCCTTATTAGTGCGAAATCTAAGGTCTCCCTCGAAAGGTCGTCTCTCTCGCGCGCCTTGAGCTTTGCGCTTTACTACTATTGA
Protein
MPPKSNKSENDLKLLYAKRDMIYSRVQTICDNALKISDLAIRDSFLCSIENIDDLRADFESIVHNINALQLELDPDYAVSYSVMSSFDDLYCRIKRVAKSLGKIPSAGYSQTEPKFTRDRPRLPPIHIPEFNGDIRNWGLFIDSFENTVNQNDHLTDHEKLHYLVEKLTGKARAACAGITFSAENYSLILNTLKAKYEDKRLIATAYLDQLFELKPILSCTEQNLEKFLDIFASSVRAIRNLNVNDLSDFLFLYIGLKKLDFETVRLFETNQGTKGIELPKFNELESFLRNHIRILQRTTRPHEVPKRQPERHLETSSRPLRTTHSYVNTAALPASVPAKSTCFLCKSYHTQLYQCAEFLKLSPKNRYDFVRTNNLCLNCLSDKHRVGVCNSSHSCRKCSLKHHTLLHFDKNNNIVANRTTSAGNQPMYGNSSLAVSSSEHSHGRTHAGGTARCTTHLARPTYSPALPAAAVAAARTDSSAAINSDGNTNDVTLCSLSSARLPTTVLLATARVVMVDTYGKPHLVRALLDSASQSNFITRECCQRLGLKYSNQPTCPVVKGIGGSTKDIQGSVKIKFESRFSSNVSFEINSLVVDKVTEQLPTVSVDTSLLANFDSLPLADDTYAVPGAVDILIGASIFPHLLLPRKVQGHSANPAPHALETVLGFVIVGSAPALINSYSTVSYCCAVEPPLDSTVRRFWEIEEVNVPLVMSPDDKTAEDIYCSTTTRDESGRYIVALPFKGDTFSLGDSRLMAEKRFFCLERKMMASPKLKKAYDDVVNEYVDKGIISPAPAVLDETQNGPSYVIPHHGVIREDKLTTKLRVVLDGSAKTSTSVSLNDILYCGKNLQGNLFDIIVNFRLFIVALSADIRQMFLCIGIRESDRRFQRFLYRFSPHEPLKVYQFNRVCFGLKSSPFHALRTVKQLVLDEGDSYPKAKATINTGLYMDDFAYSVDSEPEAIETATQVISLMKTGQFDLVKWTSNSQRVLDWIPPSHRLSTVKDFDVNDTHKILGLSWSPTSDTFSLKISSTPPTCTKRTILSCVARIWDIMGFVAPVVLYAKLLIKELWLSQCDWDDIAPDNVARLWARFREELPMLEHIEIPRHVGISRDSVVTIVGFADASEKAYGGVVYFHVCNGDNITVSLISAKSKVSLERSSLSRALSFALYYY

Summary

EMBL
GEZM01054789    JAV73399.1    GEZM01054766    GEZM01054765    JAV73410.1    LBMM01009202    + More
KMQ88311.1    GEBQ01028569    JAT11408.1    ABLF02028417    ABLF02042407    ABLF02039606    ABLF02005251    ABLF02055296    GEBQ01000825    JAT39152.1    ABLF02041614    ABLF02018732    ABLF02018737    LBMM01012238    KMQ86334.1    ABLF02041670    GGMR01009860    MBY22479.1    LBMM01008464    KMQ88855.1    GDHC01019528    JAP99100.1    JAV73413.1    GEBQ01015458    JAT24519.1    GBHO01031928    GBHO01031926    JAG11676.1    JAG11678.1    GGMR01010723    MBY23342.1    GEZM01085145    GEZM01085143    JAV60187.1    ABLF02001506    ABLF02008029    ABLF02035899    ABLF02037719    ABLF02046327    ABLF02064627    GGMS01014951    MBY84154.1    GEHC01000946    JAV46699.1    GEHC01000870    JAV46775.1    GBHO01000061    JAG43543.1    GGMS01011369    MBY80572.1    ABLF02035780    KK114194    KFM61875.1    LBMM01010417    KMQ87475.1    GGMR01003717    MBY16336.1    ABLF02008032    ABLF02035293    ABLF02060940    ABLF02030698    ABLF02030705    ABLF02030709    ABLF02015138    ODYU01012875    SOQ59395.1    GEHC01000869    JAV46776.1    GGMR01018506    MBY31125.1    KQ458473    KPJ05885.1    LNIX01000005    OXA53452.1    GEHC01000865    JAV46780.1    LNIX01000002    OXA59522.1    GBHO01034255    GBHO01034254    JAG09349.1    JAG09350.1    U23420    AAB03640.1    ABLF02022040    ABLF02056888    GGFL01005358    MBW69536.1    GAMC01006864    JAB99691.1    GGFL01004049    MBW68227.1    LNIX01000036    OXA39969.1    GBHO01030122    GBHO01030121    GBHO01030120    GBHO01030116    JAG13482.1    JAG13483.1    JAG13484.1    JAG13488.1   
Pfam
PF17921   Integrase_H2C2        + More
PF05585   DUF1758
PF03564   DUF1759
PF18701   DUF5641
PF00665   rve
PF05380   Peptidase_A17
PF00078   RVT_1
PF17919   RT_RNaseH_2
PF17917   RT_RNaseH
Interpro
IPR008042   Retrotrans_Pao        + More
IPR012337   RNaseH-like_sf       
IPR001584   Integrase_cat-core       
IPR005312   DUF1759       
IPR041588   Integrase_H2C2       
IPR008737   Peptidase_asp_put       
IPR040676   DUF5641       
IPR000477   RT_dom       
IPR036397   RNaseH_sf       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001969   Aspartic_peptidase_AS       
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
IPR041373   RT_RNaseH       
IPR041577   RT_RNaseH_2       
IPR001995   Peptidase_A2_cat       
IPR013087   Znf_C2H2_type       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
SSF50630   SSF50630       
Gene 3D

Ontologies

Topology

Length:
1168
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.47914
Exp number, first 60 AAs:
0.0004
Total prob of N-in:
0.00014
outside
1  -  1168
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
19.921586
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号