SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03669
Annotation
endonuclease_and_reverse_transcriptase-like_protein_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.39 PlasmaMembrane   Reliability : 1.064
 

Sequence

CDS
ATGAAAAGGATACAAATCAATATTCTTTTGATTTGTTTGGGGGTTGGTGCTTCCCGCTTCCGTAGCAATGTCAGGGGCCTACATAGTAACCTTGACGCCGTACACCACCACCTTGAGACGGCGCAGCCTGCCCTGCTTTTTTTAACGGAGACGCAGATATCTGCTCCGGACGATACCTCATACCTTGAATACCCCGGCTACGTATTGGAGCACAACTTCCTACGTAAAGCCGGGGTGTGCGTATTCGTCCGGGCGGATGTCTGTTGTCGCCGTCTTCGGGGCCTCGAACAACGGGACCTGTCCCTATTGTGGCTGCGCGTGGATCACGGGGGCTGTATCCGAATCTACGCGTGCCTGTACAGGTCCCACAGCAGTGATGCAGGTTCAGCTCTGTTTGAGCATGTGCAAGAGGGGACTAACCGCGTGCTTGAGCAGTACCCATCTGCGGAGGTAGTGGTTCTTGGAGACTTTAACGCTCACCACCAAGAGTGGTTGGGGTCCAGAACCACTGACCTCCCGGGTCGGACTGCCTACGATTTCGCCTTGGCCTACGGCTTCTCCCAGCTGGTGACACAGCCCACCCGTGTCCCAGATATCGAGGGGCACGAGCCTTCTTTGTTGGACCTTCTGCTGACCACAGATCCGGCCGGATACAGTGTGGTGGTCGACGCTCCGCTAGGATCGTCTGATCACTGCCTTATTCGTGCTGCCGTACCACTCTCTCGTCCCGGTCGTCGTAGGACGACCGGGTATCGTAGAGTTTGGCGGTATATGTCAGCAGATTGGGATGGATTGCGTGAATTTTACGCATCCTACCCATGGGGGCGGTTCTGCTTTTCCTCTGCTGATCCTGACGTCTGTGCGGACCGTCTTAAAGACGTGGTGCTCCGGGGGATGGAATTGTTTATTCCCTCCTCTGAAGTGCCCGTTGGGGGTCGCAGCAGACCCTGGTATAACAATGCCAGTAGGGATGCTGCACACCTCAAGCGGTCCGCATACGTGGCATGGGATAATGCCAGGAGACGTCGGGATCCTAACATCTCAGGGGAAAGGCGGAAATATAACGCCGCTTCCAGGTCCTACAAGAAGGTAATTGCCAAGGCGAAGTCGGAGCACGTTGCTAGAGTTGGCGAGCGATTAAAGAGCTATCCCTCCGGGAGCCGTGCTTTTTGGTCGCTCGCCAAAGCTGCAGAAGGAAACTTTTGCAGGGTTCCGTCTTCATGGAAGACCGCCCACGTCCACCCTATCCCCAAGAAGGGTGACCGGTCGGACCCGTCGAGCTATAGGCCTATCGCGATAACTTCCTTGCTTTCCAAGGTGATGGAGCGAATAATAAATACACAACTCCTGAAGTATCTTGAGGATCGCCAGCTGATCAGTGACCGACAGTACGGTTTCCGTCACGGTCGCTCAGCTGGCGATCTTCTTGTATACCTTACTCACAGGTGGGCTGAAGCCTTGGAGAGCAAGGGCGAGGCTCTTGCTGTGAGCCTTGATATCGCGAAGGCCTTCGACAGGGTCTGGCATAGGGCACTTCTATCGAAGCTACCATCTTACGGAATCCCCGAGGGTCTCTGCAAGTGGATCGCTAGCTTTTTGGATGGGCGGAGCATCACGGTCGTTGTAGACGGTGACTGTTCTGATACCATGACCATTAACGCTGGCGTTCCACAAGGTTCGGTGCTCTCCCCCACGCTTTTCATCCTGTATATCAATGACATGCTGTCTATTGATGGCATGCATTGCTATGCGGATGACAGCACGGGGGATGCGCGATATATCGGCCATCAGAGTCTCTCTCGGAGCGCGGTGCAAGAGAGACGATCAAAACTTGTGTCTGAAGTGGAGAACTCTCTGGGGCGAGTCTCCGAATGGGGTGAATTGAACTTGGTTCAATTCAACCCGATAAAGACACAAGTTTGCGCGTTCACTGCGAAGAAGGACCCCTTTGTCATGGCGCCGCAATTCCAAGGAGTATCCCTGCAACCGTCCGAGAGTATTGGGATACTTGGGGTCGACATTTCGAGCGATGTCCAGTTTCGGAGTCATTTGGAAGGCAAAGCCAAGTTGGCGTCCAAAATGCTGGGAGTCCTCAACAGAGCGAAGCGGTACTTCACGCCTGGACAAAGGCTTTTGCTTTATAAAGCACAAGTCCGGCCTCGCGTGGAGTACTGCTCCCATCTCTGGGCCGGGGCTCCCAAATACCAGCTTCTTCCATTTGACTCCATACAGAGGAGGGCCGTTCGGATTGTCGATAATCCCATTCTCACGGATCGTTTGGAGCCTCTGGGTCTGCGGAGGGACTTCGGTTCCCTCTGTATTTTGTACCGTATGTTCCATGGGGAGTGCTCTGAGGAGTTGTTCGAGATGATACCGGCATCTCGTTTTTACCATCGCACCGCCCGCCACCGGAGTAGAGTTCATCCATACTACCTGGAGCCACTGCGGTCATCCACAGTGCGTTTCCAGAGATCTTTTTTGCCACGTACCATCCGGCTATGGAATGAGCTCCCCTCCACGGTGTTTCCTGAGCGCTATGACATGTCCTTCTTCAAACGAGGCTTGTGGAGAGTATTAAGCGGTAGGCAGCGGCTTGGCTCTGCCCCTGGCATTGCTGAAGTCCATGGGCGACGGTAA
Protein
MKRIQINILLICLGVGASRFRSNVRGLHSNLDAVHHHLETAQPALLFLTETQISAPDDTSYLEYPGYVLEHNFLRKAGVCVFVRADVCCRRLRGLEQRDLSLLWLRVDHGGCIRIYACLYRSHSSDAGSALFEHVQEGTNRVLEQYPSAEVVVLGDFNAHHQEWLGSRTTDLPGRTAYDFALAYGFSQLVTQPTRVPDIEGHEPSLLDLLLTTDPAGYSVVVDAPLGSSDHCLIRAAVPLSRPGRRRTTGYRRVWRYMSADWDGLREFYASYPWGRFCFSSADPDVCADRLKDVVLRGMELFIPSSEVPVGGRSRPWYNNASRDAAHLKRSAYVAWDNARRRRDPNISGERRKYNAASRSYKKVIAKAKSEHVARVGERLKSYPSGSRAFWSLAKAAEGNFCRVPSSWKTAHVHPIPKKGDRSDPSSYRPIAITSLLSKVMERIINTQLLKYLEDRQLISDRQYGFRHGRSAGDLLVYLTHRWAEALESKGEALAVSLDIAKAFDRVWHRALLSKLPSYGIPEGLCKWIASFLDGRSITVVVDGDCSDTMTINAGVPQGSVLSPTLFILYINDMLSIDGMHCYADDSTGDARYIGHQSLSRSAVQERRSKLVSEVENSLGRVSEWGELNLVQFNPIKTQVCAFTAKKDPFVMAPQFQGVSLQPSESIGILGVDISSDVQFRSHLEGKAKLASKMLGVLNRAKRYFTPGQRLLLYKAQVRPRVEYCSHLWAGAPKYQLLPFDSIQRRAVRIVDNPILTDRLEPLGLRRDFGSLCILYRMFHGECSEELFEMIPASRFYHRTARHRSRVHPYYLEPLRSSTVRFQRSFLPRTIRLWNELPSTVFPERYDMSFFKRGLWRVLSGRQRLGSAPGIAEVHGRR

Summary

Uniprot
ProteinModelPortal
PDB
6AR3     E-value=1.1491e-05,     Score=120

Ontologies

GO

Topology

SignalP
Position:   1 - 17,         Likelihood:  0.843974
 
 
Length:
878
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0507400000000001
Exp number, first 60 AAs:
0.04686
Total prob of N-in:
0.00276
outside
1  -  878
 
 

Population Genetic Test Statistics

Pi
3.592735
Theta
12.719479
Tajima's D
-1.662783
CLR
35.171225
CSRT
0.0394980250987451
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号