SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03668
Pre Gene Modal
BGIBMGA002210
Annotation
PREDICTED:_uncharacterized_protein_LOC101737771_isoform_X3_[Bombyx_mori]
Transcription factor
Location in the cell
Nuclear   Reliability : 4.731
 

Sequence

CDS
ATGCCTGATACTCATCGTACTTGTGAAGTTTGTGGTATCAAAGAAAGACATCTTAATGAAAAACGGTTTTTCGCAAGGTTTCCTCTGGATGTCAATAGATGTAAAGAGTGGGTAAAAATAGTTGGCAAAGAAGATCTGGCTTATCTTCAAGTACATATGCTACATGATTTAAAACATGTTTGTGAAGTACATTTCTCAAGGCGAGACTTTACAAAATCAAAGAAGCGCTTAAAAAAACGAGCTGTACCCAAACTGAACTTGACACTGCCACCATTGAGAGATGAAATTCTTTTTCAATTTTTGCAACTTAACTCACAAGTGGATGTCACCCCACAAGGCCAGTTTGAGGTTCAGGCAGTTCCTAGTGCTTCAATGCCAGCATCCTCAAGTCAGCCTAGCAGTCTAGAGAAAACGGATGTCACCCCACAGGGCCAGTTTGAGGTTCAGGCTGTTCCTAGTGCTTCAATGCCGACATCCTCAGACGTCACCACACGAAGCCAGCATAAGGAAAGTGAAAGTCAAATAAGAAAAAGAAAATTAGAAGATGTTGATGTAACACCACGGAAAAGTAGGCTCTTAAGTGAATTGAGAAAAACAAAGTGCACATTGGAATCATTTAAAAAGAGCGCGAAACTAACAGAAAATTTATCGTCAGAATTTCTAAAAGAAATTGTCACGTCCGCGTTGAAAAATCAAAAGCTTTTCGGGTTTAAAGATGGAGACAATCAAGGTCAAGATATTAATGAGTCTTCTAGTAAAGTTTCCACAGAAAATGAAAATGAGGTTCTCAGTATACCTGAAGAAGAAGAGTATAAAGAAATAGCTGTTGTACTTTTCCAAAACATGGTAGGGAAAGGAAGTGTAAAATGCTCAAAATGCGGTATAACATCAAAAGAAGATTTTTCCTTAACCTTCCATAGGTTTCCTCTTCCGTCCAAGCATGGGTCTCTGAGGGCTACAGTTTGGGCTAAATTTTGTTTTCCTGATGGTGATTGGACATCCAATGAATCATTAGAAAATTTGAACGCACAGCATAGGATGCTATGTGGCAATCATTTTGATGATTCTTCATTTACCAGCAGCAACAGGAAAAGACTTAACAAGTTTGCTATACCATCTGAAGCTCAAAGTATACTTTCCCAATTAAGAGAAGAACAGTGTAGTCCATCTAGAGCAAGTCATGACATCCAAGTGAGTATTTACCTAGTTTACTTTATAATCATAAAAATATTGCTCTAA
Protein
MPDTHRTCEVCGIKERHLNEKRFFARFPLDVNRCKEWVKIVGKEDLAYLQVHMLHDLKHVCEVHFSRRDFTKSKKRLKKRAVPKLNLTLPPLRDEILFQFLQLNSQVDVTPQGQFEVQAVPSASMPASSSQPSSLEKTDVTPQGQFEVQAVPSASMPTSSDVTTRSQHKESESQIRKRKLEDVDVTPRKSRLLSELRKTKCTLESFKKSAKLTENLSSEFLKEIVTSALKNQKLFGFKDGDNQGQDINESSSKVSTENENEVLSIPEEEEYKEIAVVLFQNMVGKGSVKCSKCGITSKEDFSLTFHRFPLPSKHGSLRATVWAKFCFPDGDWTSNESLENLNAQHRMLCGNHFDDSSFTSSNRKRLNKFAIPSEAQSILSQLREEQCSPSRASHDIQVSIYLVYFIIIKILL

Summary

Uniprot
ProteinModelPortal
PDB
2D8R     E-value=0.0105872,     Score=91

Ontologies

Topology

Length:
412
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.07924
Exp number, first 60 AAs:
0
Total prob of N-in:
0.01720
outside
1  -  412
 
 

Population Genetic Test Statistics

Pi
18.99387
Theta
17.906028
Tajima's D
-1.3955
CLR
0.609711
CSRT
0.0745962701864907
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号