SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03654
Annotation
PREDICTED:_uncharacterized_protein_LOC106133664_[Amyelois_transitella]
Location in the cell
Nuclear   Reliability : 3.824
 

Sequence

CDS
ATGAAACCGAATCCTTGCTTAGAAAAAAACTGTCGCTACAAGTGTCAAGAAATAACCTCAGAAAAAATGAGTGCCATATTTAAACATTTTTGGGAATTATCTCTGGAAAGAAAAAAGCAGTGGATAATATCTATGTCCTCTAAGCAATCCATAAAAAGGAAGAGATCCAAAGACTCTAATTACAGGAATAACACATTCTGTTATTTCATAAATGATGGAGAGGGTCGGCGACAAGTTTGTTTAAAGTTACTCATGAATACGCTTGATGTCACTCAAAGATACATTTATTATACATTAACAACACAGGAACTTGGTATGGCGAAAGAAAATGGAAGAGGAAAATGCATTCCCCCCAACAAAACATCTAACGCAATCAAAGAATCAGTAAAATCTTTTATCAAAAGGTTACCTGCAATACCATTGCACTACTGCCGAAAGGATAGCACAAAACTATATCTGCCTGTTGAATTTAAAAATATAAAAAATTTATACCGCTGTTATAAAGAAGACCTCATTAGTAAAGGAGTCGATGTTGTAAGTGAAAAAGTATTCCGTCAAATATTCACTACTGATTTTAACATTGGGTTTCATGTGTCTAAGAAGGATAAATGCATAAAATGCCTACGTTTTGAAGGACAGAAGCCAGAGGATTGTGCCGAATTTCAAGATCATTTAGAGGAAAAGAAGGCATCAAAGAAGCGGTTAGAATGTCATCGACAGTTAGGTAAAGAAAATCCTTCCATTCTGTGCACATCTTTTGACCTCCAGAAAGTTCTCGATACGCCTCATGGCAATAACATGTTACTATTTTATTCTAGAAAGTATGCTGTTTATAATTTATGTTTTTATGAAAGCATCACAAGGAATGGTTTTTGTTTTATCTGGAGAGAATCTGAAGCAAAGAGGGGCGCAAATGAAATTGCTACTATTATACAGAAATACATAGAGAATGTGGATTCTCGAGGTATCATTACATCTTTGATCTTGTATTCAGATTCTTGCCCTGGACAAAACAAAAATAAAATAGTCCTTGCAACAATACATAATGCTTTGTTGCAATCGAACAATTTACAAGCAATTCAAATGAATTACCTTCTCCCTGGCCACACGGAAATGTCGGTAGACAGCATACACTCTACAATCGAACAATCCGTAAGAAATATTACTGTATGGGCCCCTTCGCAATGGGCTACAATAAGCCAGCTAGCAAGAAAAGAACCAGCACCTTATAATGTTGAAAATCTGACACACGAGGATTTCTTAAATTTTGATGATATGTCAGAAAAATATTTTAAGGGTAACCTTGTAGGTAAAATTAGTAAAATCCGTACAGCAACATTTAAAAAATCTCATCCAAATCAAATGAAAGTAAAATTTTCAATGAAAGATAATGCATCCGAAGAGATTATACAAATTATTGCGAAACCTAGAGCTATCAATCGTAGATATAATTCAAGTTTGCCGATTACCAAAGCCAAATACCAACAGCCAAAACCTAAAGAAATTATGTGA
Protein
MKPNPCLEKNCRYKCQEITSEKMSAIFKHFWELSLERKKQWIISMSSKQSIKRKRSKDSNYRNNTFCYFINDGEGRRQVCLKLLMNTLDVTQRYIYYTLTTQELGMAKENGRGKCIPPNKTSNAIKESVKSFIKRLPAIPLHYCRKDSTKLYLPVEFKNIKNLYRCYKEDLISKGVDVVSEKVFRQIFTTDFNIGFHVSKKDKCIKCLRFEGQKPEDCAEFQDHLEEKKASKKRLECHRQLGKENPSILCTSFDLQKVLDTPHGNNMLLFYSRKYAVYNLCFYESITRNGFCFIWRESEAKRGANEIATIIQKYIENVDSRGIITSLILYSDSCPGQNKNKIVLATIHNALLQSNNLQAIQMNYLLPGHTEMSVDSIHSTIEQSVRNITVWAPSQWATISQLARKEPAPYNVENLTHEDFLNFDDMSEKYFKGNLVGKISKIRTATFKKSHPNQMKVKFSMKDNASEEIIQIIAKPRAINRRYNSSLPITKAKYQQPKPKEIM

Summary

EMBL
ABLF02010023    ABLF02004257    ABLF02029811    ABLF02012672    ABLF02018334    ABLF02014818    + More
ABLF02014820    GEZM01058056    GEZM01058054    GEZM01058052    GEZM01058051    GEZM01058048    JAV71930.1    ABLF02012895    ABLF02009246    ABLF02009249    ABLF02012670    ABLF02012673    ABLF02042537    ABLF02044751    ABLF02007876    GGMR01020048    MBY32667.1    AAGJ04087115    ABLF02008707    ABLF02008709    AAGJ04159061    AAGJ04019135    AAGJ04019136    AAGJ04019137    RSAL01000569    RVE41377.1    KB200426    ESP01684.1    ABLF02010195    ABLF02010196    ABLF02055224    ABLF02023797    BABH01025621    GGMR01008668    MBY21287.1    ABLF02009832    ABLF02009835    RSAL01005524    RVE40000.1    GEZM01016759    JAV91146.1    RSAL01000142    RVE46021.1    ABLF02026661    ABLF02026674    ABLF02026675    ABLF02041813    ABLF02060074    GBHO01042097    JAG01507.1    ODYU01004805    SOQ45064.1    ABLF02010095    AAGJ04142602    GEZM01027265    JAV86789.1    RSAL01000260    RVE43346.1    ABLF02016629    ODYU01011180    SOQ56761.1    ABLF02003967    ABLF02004635    GGMR01008791    MBY21410.1    RSAL01000210    RVE44232.1    ODYU01012570    SOQ58975.1    ABLF02019640    ABLF02019643    ABLF02019649    ABLF02037175    ABLF02037177    ABLF02022524    ABLF02013311    ODYU01004340    SOQ44104.1    ABLF02013766    ABLF02039177    ABLF02004032    ABLF02042646    ACPB03016567    ACPB03016568    ABLF02024894    ABLF02024897    KK107242    EZA54533.1    AMQN01021160    AMQN01021161    KB298212    ELU09529.1    KB202199    ESO91835.1    KK107128    EZA58416.1    RJVU01027735    ROL48958.1    NWSH01003159    PCG66844.1    MRZV01000115    PIK58358.1    ABLF02020246    BABH01033861    KZ150145    PZC72904.1    ACPB03009534    ABLF02015617    ABLF02015622    RSAL01000009    RVE53882.1    UFQS01001897    UFQT01001897    SSX12663.1    SSX32106.1    GECZ01029139    JAS40630.1    GEZM01023604    JAV88283.1    GEZM01010383    JAV94073.1    AAGJ04162991    RQTK01001146    RUS71879.1    GECU01006037    JAT01670.1    RSAL01000213    RVE44164.1    ODYU01009390    SOQ53782.1    ABLF02033230    AAGJ04038612    AAGJ04038613    GGMR01003297    MBY15916.1    GAKP01007365    JAC51587.1    AJVK01029962    GBXI01005713    JAD08579.1    LNIX01000025    OXA42761.1    LNIX01000005    OXA53581.1    ODYU01002004    SOQ38964.1    ABLF02006015    GEBQ01029058    JAT10919.1    ABLF02021172    KK854960    PTY19956.1   
Pfam
PF00078   RVT_1        + More
PF01192   RNA_pol_Rpb6
PF13359   DDE_Tnp_4
PF16064   DUF4806
PF04500   FLYWCH
PF10551   MULE
PF04218   CENP-B_N
Interpro
IPR018247   EF_Hand_1_Ca_BS        + More
IPR000477   RT_dom       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR020708   DNA-dir_RNA_polK_14-18kDa_CS       
IPR036161   RPB6/omega-like_sf       
IPR006110   Pol_omega/K/RPB6       
IPR012293   RNAP_RPB6_omega       
IPR027806   HARBI1_dom       
IPR032071   DUF4806       
IPR012337   RNaseH-like_sf       
IPR018289   MULE_transposase_dom       
IPR007588   Znf_FLYWCH       
IPR009057   Homeobox-like_sf       
IPR007889   HTH_Psq       
IPR036388   WH-like_DNA-bd_sf       
SUPFAM
SSF63562   SSF63562        + More
SSF53098   SSF53098       
SSF46689   SSF46689       
Gene 3D

Ontologies

Topology

Length:
503
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00575
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00310
outside
1  -  503
 
 

Population Genetic Test Statistics

Pi
0.460469
Theta
2.506373
Tajima's D
-2.018421
CLR
0.709948
CSRT
0.0071996400179991
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号