SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03645
Annotation
PREDICTED:_RNA-directed_DNA_polymerase_from_mobile_element_jockey-like_[Amyelois_transitella]
Location in the cell
Mitochondrial   Reliability : 2.409
 

Sequence

CDS
ATGGACATTTTGGCTTCTCTTCATTCAAAAAAAAGTTTCTCATCATTTTGGAAGAGTACTAAAAAATTTGATAAATCACCAAGTCTTCCAGTTAGCGTGGAGGGTGAGAGTGACTACATTGGAATAGCAAATATATTTAAAGATCATTTTAAAGTAATTTCTCCATTAAAGACAGCGTCGTTGAGGAATGGTGCTGAGTTCTGTCAATCAGGTTTGCCAGTTCATTTTACATGTAAAGAAATAAAAACTGTTATAAAGGGTATGAAAAGAGGCAAGTCTCCTGGTAATGATGGACTCAGCATCGAGCATCTCCAGAATTCTGGTGTTCACCTGCCGAGAGTTTTGACTATGTTGTTCAATTTGTTTGTGGGGCATTCTCACTTACCAAGGGAGATGTTGGACACAATAGTTGTACCTATTGTAAAAAACAGGACAGGAGACATAGCGGACAAGGGAAATTATAGACCAATTTCACTGGCAACCGTCATAGCCAAGGTGTTTGACAGCGTGCTTGACTCACATCTCAGTGGATACACTAAACTGCATGATACACAGTTTGGATTTTGTGCTGGGCTATCTACTGAGAGTGCCATTTTTGCACTGAAGCATGCTGTCAAATACTACACTGATAGGAAAACACCAGTGTATGCCTGTTTCCTGGACCTATCAAAAGCCTTTGACCTTGTTTCCTATAATATCTTGTGGGAAAAGCTACTGGGAGAGGGTGTACTTCCTTCATTAGTAAATATATTATCTTTGTGGTATGAGAAGCAGAGGAACTTTGTACGGTGGTCCAATGTACTGTCAGACCCTTACAAACTAGAATGTGGTGTAAGGCAGGGTGGTTTGACCTCCCCGAGGCTCTTTAATATATATGTAAATAAGCTACTTGAGGAGCTCAGTAGCACACATGTTGGTTGTCATATAGATAATTTGTGTCTTAATAACATTAGCTATGCGGATGACATGGTGCTGCTGAGCCCATCAATATGTGGGTTAAGAAAGTTGCTTTCCATATGTGAATCCTATGCTGAGGATCATGGCTTAAAGTATAACCCTAGTAAAAGTGAGCTGTTGGTGTTCAGAGGTGTAAACAAAAGTCCACCTCATGTCCCGCCTCTAATGCTCGGTGGCTTACCTGTACAAAGAGTAGCACAGTTCAAATATCTAGGGCATATTGTAACTGAGGAATTAAAAGATGATATGGACATGGAAAGGGAACGCAGGGCATTGGCTGTCAGAGGGAATGTAGTGGCACAAAGATTTGCAGGTTGTTCAGTGCCGGTCAAAATTACCCTCTTCAAGGCTTACTGCCAAACCTTTTACACAAGCGGTCTTTGGGCTACTCATACCCAAAAAACGGATAATGCCCTGCGCATACAATATAATAATGCCTTCAGGGCGTTGTTGAGGCTTCCACCTTATTGTAGTGCATCAGGCATGTTCGCCGATGCGCACACGGATGACTACTTCGCGATAATGCGCAAAAAGGTGGCATCCATTATGCGTAGAGTAGGAGGAAGCACCAACAACGTCTTGAGGGTACTAGCTGAAAGACTGGATGGCCCGACCCTGGGTAGGTTCATCAAGTTGCATGTTCTACATGCTGCTTGA
Protein
MDILASLHSKKSFSSFWKSTKKFDKSPSLPVSVEGESDYIGIANIFKDHFKVISPLKTASLRNGAEFCQSGLPVHFTCKEIKTVIKGMKRGKSPGNDGLSIEHLQNSGVHLPRVLTMLFNLFVGHSHLPREMLDTIVVPIVKNRTGDIADKGNYRPISLATVIAKVFDSVLDSHLSGYTKLHDTQFGFCAGLSTESAIFALKHAVKYYTDRKTPVYACFLDLSKAFDLVSYNILWEKLLGEGVLPSLVNILSLWYEKQRNFVRWSNVLSDPYKLECGVRQGGLTSPRLFNIYVNKLLEELSSTHVGCHIDNLCLNNISYADDMVLLSPSICGLRKLLSICESYAEDHGLKYNPSKSELLVFRGVNKSPPHVPPLMLGGLPVQRVAQFKYLGHIVTEELKDDMDMERERRALAVRGNVVAQRFAGCSVPVKITLFKAYCQTFYTSGLWATHTQKTDNALRIQYNNAFRALLRLPPYCSASGMFADAHTDDYFAIMRKKVASIMRRVGGSTNNVLRVLAERLDGPTLGRFIKLHVLHAA

Summary

EMBL
KZ150185    PZC72467.1    NHMN01024349    PZC87407.1    RSAL01000132    RVE46368.1    + More
NWSH01000012    PCG80896.1    KZ150122    PZC73158.1    KZ150039    PZC74591.1    KZ149940    PZC76937.1    RSAL01004459    RVE40147.1    GAIX01014011    JAA78549.1    KZ150625    PZC70440.1    HAEJ01003895    SBS44352.1    GCES01119762    JAQ66560.1    GCES01122004    JAQ64318.1    GCES01120657    JAQ65665.1    ODYU01003417    SOQ42157.1    GCES01018090    JAR68233.1    GCES01147931    JAQ38391.1    GCES01120011    JAQ66311.1    GDRN01099830    JAI58698.1    DMQF01000507    HAO15811.1    DNUT01000366    HBI40674.1    GBHO01007597    JAG36007.1    GU815089    ADF18552.1    GEZM01094272    GEZM01094271    JAV55745.1    MPRK01000277    OOZ37539.1    GDHC01004388    JAQ14241.1    AAGJ04127121    AAGJ04127122    AAGJ04127123    AAGJ04058037    GGMS01004979    MBY74182.1    GEZM01043747    JAV78865.1    GEZM01043748    JAV78864.1    KQ484600    KYP34423.1    GBHO01011985    JAG31619.1    GEBQ01025973    JAT14004.1    GBRD01015171    JAG50655.1    GBHO01016428    JAG27176.1    GFTR01008507    JAW07919.1    IACL01060951    LAB07281.1    LBMM01001656    KMQ95932.1    GDHC01019542    JAP99086.1    GFTR01008539    JAW07887.1    GEZM01094174    JAV55841.1    GEZM01094173    JAV55843.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF12832   MFS_1_like
PF03372   Exo_endo_phos
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR000477   RT_dom       
IPR024989   MFS_assoc_dom       
IPR005135   Endo/exonuclease/phosphatase       
IPR036259   MFS_trans_sf       
IPR020846   MFS_dom       
SUPFAM
SSF56219   SSF56219        + More
SSF103473   SSF103473       
Gene 3D
PDB
5IRG     E-value=7.99029e-05,     Score=111

Ontologies

Topology

Length:
537
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.02735
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00119
outside
1  -  537
 
 

Population Genetic Test Statistics

Pi
4.031435
Theta
14.2568
Tajima's D
-1.828663
CLR
14.516054
CSRT
0.0243987800609969
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号