SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03606  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA006273
Annotation
PREDICTED:_glucose_transporter_type_1-like_isoform_X1_[Amyelois_transitella]
Full name
Glucose transporter type 1      
Location in the cell
PlasmaMembrane   Reliability : 4.966
 

Sequence

CDS
ATGTCGAGCGGTGGTACAACGGGGGCACTGCTGTACGCGGTGAGCGCGGCCGTCTTGGGAATGCTACAATTCGGCTTTAACACCGGCGTCATTAACGCCCCGAGAAAATTCATAGAGAACTTCGTACGTGATAATTACGAAGCGAAGCCGTCGCTCATTTTTAGTGTTATCGTCAGCATATTCGCCGTAGGAGGCATGATTGGATGTCCACTTGCCAGTTGGATGCTCGATACTCAGGGACGAAAGAAAGCCTTGCTCTATAACGCAGCATTCGGTATTATTGGAGCAGCTTTTATGGGTTTCAGTAAATTGGCGACTTCAGTTGAAATGCTCATCATTGGTAGATTCCTGATTGGAATCAACTGTGGCTTCGCAACGACGGCCTCGCCTACATACGTCTCCGAGATAGCACCGGTAAGAATGCGCGGCGCTTTCGGCACCGTAAACCAATTAGCTGTAGGATTCGGCATGACCTGTGGCCAGATTTTGGGTATTGATGTGATTTTGGGTAGCGACGAAGGCTGGCCGCTGTTGCTCGGATTAGCGGTCGTTCCGGCTGCCATTCAATTAATTATGCTACCGTTCGCGCCCGAATCACCAAGGTATTTGTTGCTATGCGCCCACGACGAAGAGAAAGCGAGAGTGGCCTTGACTAAAATTCGAGGCAGCAGCGATGTAGAAAACGAAATTAACGATATGCACCTTGAAGATCAAGCGGCCAGAGAAGAGCAGAAGTTCTCCGTGAAGGATTTGTTCACGACCCCAGCCCTAAGGATACCCCTCGTGATTGGTATCGTGATGCATTTATCCCAACAGTTGGGCGGAATCAACGCGGTATTGTACTATTCCTCCACGATATTTGTAAAAGCCGGTTTGTCTGAAGAAGACGCCCGGTTAGCTGTGATCGGTGTGGGCAGCATTCTTTTCGTGATGGCCCTCGTGTCGATTCCTCTGATGGACCGACTCGGCCGACGGACTCTGCAGCTGTGCGGTCTCGGCGGCATGACCGCATTCTCTATACTGATGACGATCGCGTTCTTCACGTACGAGAACAACACGACGATGAGTATATTCGCCGTGATATTCACATTCTTGTACGTCGCGTTCTTCGGTGTCGGACCTAGTTCGATCCCGTGGATGATCCTGTCGGAGTTGTTTGGTCAGGGAGCCAGGAGCGCGGCCGTCAGCGTCGGCGCTCTCGTTAACTGGTTCGCGAACTTCGTCGTGGGTCTAACGTTCATTCCTATGTCGGAAGCATTGGGGAACTACGTTTTCATACCGTACACGATCCTACTGATTATATTCTTCGTGTTCACGTATTTGAAGCTGCCCGAGACTAAGAACAGAACGATCGAGGAGGTGACGGCTCTCTTCAAGAAGTAG
Protein
MSSGGTTGALLYAVSAAVLGMLQFGFNTGVINAPRKFIENFVRDNYEAKPSLIFSVIVSIFAVGGMIGCPLASWMLDTQGRKKALLYNAAFGIIGAAFMGFSKLATSVEMLIIGRFLIGINCGFATTASPTYVSEIAPVRMRGAFGTVNQLAVGFGMTCGQILGIDVILGSDEGWPLLLGLAVVPAAIQLIMLPFAPESPRYLLLCAHDEEKARVALTKIRGSSDVENEINDMHLEDQAAREEQKFSVKDLFTTPALRIPLVIGIVMHLSQQLGGINAVLYYSSTIFVKAGLSEEDARLAVIGVGSILFVMALVSIPLMDRLGRRTLQLCGLGGMTAFSILMTIAFFTYENNTTMSIFAVIFTFLYVAFFGVGPSSIPWMILSELFGQGARSAAVSVGALVNWFANFVVGLTFIPMSEALGNYVFIPYTILLIIFFVFTYLKLPETKNRTIEEVTALFKK

Summary

Description
Facilitative glucose transporter.
Similarity
Belongs to the major facilitator superfamily. Sugar transporter (TC 2.A.1.1) family.
Belongs to the major facilitator superfamily. Sugar transporter (TC 2.A.1.1) family. Glucose transporter subfamily.
Keywords
Alternative splicing   Complete proteome   Glycoprotein   Membrane   Reference proteome   Signal   Sugar transport   Transmembrane   Transmembrane helix   Transport  
Feature
chain  Glucose transporter type 1
splice variant  In isoform T.
EMBL
BABH01026028    KZ149893    PZC78941.1    NWSH01000685    PCG74784.1    PCG74785.1    + More
PCG74786.1    ODYU01010734    SOQ56033.1    JTDY01001482    KOB73768.1    KQ460647    KPJ13189.1    KQ459249    KPJ02380.1    AGBW02010349    OWR48659.1    AF064703    AE014296    AY059441    BT011383    AAC36683.2    AAL13347.1    GFDF01007795    JAV06289.1    KA644535    AFP59164.1    GGFK01009940    MBW43261.1    AHN57921.1    GAMC01016783    GAMC01016782    JAB89772.1    GGFM01004405    MBW25156.1    ADMH02001654    ETN61547.1    GGFL01001239    MBW65417.1    GAPW01000720    JAC12878.1    ALI30448.1    JR035629    JR035630    AEY56555.1    AEY56556.1    GFDL01003014    JAV32031.1    KZ288223    PBC32012.1    CH477280    EAT44948.1    GFDF01007799    JAV06285.1    AHN57920.1    AAAB01008807    EAA04274.4    LBMM01005725    KMQ91266.1    QOIP01000006    RLU21458.1    KK107485    EZA50096.1    OUUW01000009    SPP84932.1    GFDL01003013    JAV32032.1    GGFL01004974    MBW69152.1    CH916366    EDV97447.1    GEDC01019533    JAS17765.1    CM000363    EDX08746.1    GEDC01020449    JAS16849.1    KQ414627    KOC67429.1    EAA45418.4    KF803268    AHF27422.1    GEDC01021510    JAS15788.1    GEDC01014486    JAS22812.1    GBBI01002207    JAC16505.1    KY350171    ARX98210.1    ACPB03000235    CH480817    EDW49982.1    GDIQ01162459    JAK89266.1    KQ434938    KZC12054.1    GDIQ01045860    JAN48877.1    GDHC01020905    JAP97723.1    ADTU01021729    ADTU01021730    ADTU01021731    ADTU01021732    GL888384    EGI61918.1    LRGB01001899    KZS10076.1    GECL01002228    JAP03896.1    GFTR01006667    JAW09759.1    GEDC01021687    JAS15611.1    GEDC01014065    JAS23233.1    GBGD01001272    JAC87617.1    GL769399    EFZ10419.1    GEDC01000676    JAS36622.1    GEDC01002354    JAS34944.1    CH933809    EDW19603.2    GDHC01007983    JAQ10646.1    CH940647    KRF84716.1    KQ976417    KYM89830.1    GEDC01012296    JAS25002.1    GDKW01002826    JAI53769.1    GECZ01020223    JAS49546.1    GEDC01029784    JAS07514.1    HACA01019526    CDW36887.1    KQ981953    KYN32497.1    KQ982766    KYQ50974.1    GDIP01175871    JAJ47531.1    GGLE01001423    MBY05549.1    GEBQ01013546    JAT26431.1    AB901049    BAQ02349.1    GEBQ01020250    JAT19727.1    GECU01012117    JAS95589.1    GEBQ01003006    JAT36971.1    KQ981124    KYN09323.1    GDIP01175870    JAJ47532.1    GDIP01175869    JAJ47533.1    GL452187    EFN77800.1   
Pfam
PF00083   Sugar_tr
Interpro
IPR005828   MFS_sugar_transport-like        + More
IPR003663   Sugar/inositol_transpt       
IPR020846   MFS_dom       
IPR005829   Sugar_transporter_CS       
IPR036259   MFS_trans_sf       
SUPFAM
SSF103473   SSF103473       
PDB
5EQI     E-value=5.25229e-105,     Score=974

Ontologies

Topology

Subcellular location
Membrane  
Length:
460
Number of predicted TMHs:
11
Exp number of AAs in TMHs:
250.57739
Exp number, first 60 AAs:
31.38045
Total prob of N-in:
0.37146
POSSIBLE N-term signal
sequence
outside
1  -  9
TMhelix
10  -  32
inside
33  -  51
TMhelix
52  -  74
outside
75  -  83
TMhelix
84  -  106
inside
107  -  110
TMhelix
111  -  133
outside
134  -  147
TMhelix
148  -  170
inside
171  -  176
TMhelix
177  -  196
outside
197  -  298
TMhelix
299  -  318
inside
319  -  324
TMhelix
325  -  347
outside
348  -  356
TMhelix
357  -  379
inside
380  -  391
TMhelix
392  -  414
outside
415  -  418
TMhelix
419  -  441
inside
442  -  460
 
 

Population Genetic Test Statistics

Pi
29.727212
Theta
25.854521
Tajima's D
0.269047
CLR
0.241769
CSRT
0.454777261136943
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号