SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03596
Pre Gene Modal
BGIBMGA002632
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.308
 

Sequence

CDS
ATGGATTGGGATGGATTGCGTGAGTTTTACGCATCCTACCCATGGGGGCGGTTCTGCTTTTCCTCTGCTGATCCTGACGTCTGTGCGGACCGTCTTAAAGACGTGGTGCTCCAGGGGATGGAATTGTTTATTCCCTCCTCTGAAGTGCCCGTTGGGGGTCGCAGCAGACCCTGGTATAACAATGCCAGCAGGGATGCTGCACACCTCAAGCGGTCCGCATACGTTGCATGGGATGATGCTAGGAGACGTCGGGATCCTAACATCTCAGAGGAAAGGCGGAAATATAACGCCGCTTCCAGGTCCTACAAGAAGGTTATTGCCAGGGCGAAATCGGAGCACGTTGCTAGAATTGGCGAGCGACTGAAGAGCTATCCCTCTGGGAGCCGTGCTTTTTGGTCGCTCGCCAAAGCTGCAGAAGGTAACTTTTGCAGGTCTAGTCTCCCACCACTACGCAAGTCCGATGACAGTCTGGCCCATAGTGCGAAAGAGAAGGCTGACCTTCTGGTCAAACTCTTCGCCTCGAACTCGACTGTGGACGACGGGGGTGCCACACCACCGAACATCCTCCGGTGTGATAGTTCCCTGCCGGAGATCTGCTTTACACAGTGTGCAGTCAGGCGGGAACTCCGACTCCTGGACGTCCATAAGTCGAGCGGGCCAGACGGCATCCCTGCAGTGGTTCTGAAAACGTGCGCCCCTGAGCTGACGCCTGCGCTAACGCGTTTGTATCGCCTCTCTTATTGCGCTAACAGGGTTCCGTCTTCATGGAAGACTGCCCACGTCCACCCTATCCCCAAGAAGGGTGACCGGTCGGACCCATCGAGCTACAGGCCTATCGCGATAACTTCCTTGCTTTCCAAGGTGATGGAGCGAATAATTAATATACAACTCCTGAAGTATCTGGAGGATCGCCAGCTGATCAGTGACCGACAGTACGGTTTCCGTCACGGTCGCTCAGCTGGCGATCTTCTTGTATACCTTACTCACAGGTGGGCTGAAGCCTTGGAGAGCAAGGGCGAGGCTCTTGCTGTGAGCCTTGATATTGCGAAGGCCTTCGACAGGGTCTGGCATAGGGCACTTCTGTCGAAGCTACCATCTTACGGAATCCCCGAGGGTCTCTGCAAGTGGATCGCTAGCTTTTTGGATGGGCGGAGCATCACGGTCGTTGTAGACGGTGACTGTTCTGATACCATGACCATTAACGCTGGCGTTCCACAAGGTTCGGTGCTCTCCCCCACGCTTTTCATCCTGTATATCAATGACATGCTGTCTATTGATGGCATGCATTGCTATGCGGATGACAGCACGGGGGATGCGCGATATATCGGCCATCAGAGTCTCTCTCGGAGCGTGGTGCAAGAGAGACGATCAAAGCTTGTGTCTGAAGTGGAGAACTCTCTGGGGCGAGTCTCCAAATGGGGTGAATTGAACTTGGTTCAATTCAACCCGTTAAAGACACAAGTTTGCGCGTTCACTGCGAAGAAGGACCCCTTTGTCATGGCGCCGCAATTCCAAGGAGTATCCCTGCAACCTTCCGAGAGTATTGGGATACTTGGGGTCGACATTTCGAGCGATGTCCAGTTTCGGAGTCATTTGGAAGGCAAAGCCAAGTTGGCGTCCAAAATGCTGGGAGTCCTCAACAGAGCGAAGCGGTACTTCACGCCTGGACAAAGGCTTTTGCTTTATAAAGCACAAGTCCGGCCTCGAATGGAGTACTGCTCCCATCTCTGGGCCGGGGCTCCCAAATACCAGCTTCTTCCATTTGACTCCATACAGAGGAGGGCCGTTCGGATTGTCGATAATCCCGGTCTCACGGATCGTTTGGAACCTCTGGGTCTGCGGAGGGACTTCGGTTCCCTCTGTATTTTGTACCGTATGTTCCATGGGGAGTGCTCTGAGGAATTGTTCGAGATGATACCGGCATCTCGTTTTTACCATCGCACCGCCCGCCACCGGAGTAGAGTTCATCCATACTACCTGGAGCCACTGCGGTCATCCACAGTGCGTTTCCAGAGGTCTTTTTTGCCACGTACCATCCGGCTATGGAATGAGCTCCCCTCCACGGTGTTTCCCGAGCGCTATGACATGTCCTTCTTCAAACGAGGCTTGTGGAGAGTATTAAGCGGTAGGCAGCGGCTTGGCTCTGCCCCTGGCATTGCTGAAGTCCATGGGCGACGGACCATGACTCGACTTGAACGGCTACCCCAAGTGGCTAAAGTCATGCAAGAATACAACATTCACATTCTTGGATTGAGTGAGACGAGATGGAACGGTTTTGGAGAAACGCAATGTGATTTTGGATACTCGTTATTGTACAGTGGTAAGGAAGAGGATGCGACCCGAGAGTATGGCGTGGGTTTGCTGCTAAGTCGCAGCGCTAAAAGTAGCTTACTCTCTTGGAAGCCAGTCTCGGAACGAATAATATGCGCCAGATTCTCGACACGAGTACGGAAGGTGACAGTGATACAATGCTACGCTCCCACTAACTCTGCTTCGACCGATGTAAAGTCACAATTCTACGAACAGCTGGGGCATACACTCAAAGGCATCAAGAAACAAGATATCGTGATTCTCATGGGCGACATAAATGCGAAGATGGGAAATGACAATGTAGACCGCGAATATTACATGGGACAATATGGGGCAACCGGAACTATTAACGAAAACGGAGAACTTTTCGGTGATCTATGTTCCACACATGGTCTAGTTATTGGAGGTACCCTATTTAAGCATAAGGAATGTCATAAAGTTACTTGGATATCACCGGACGGAAAGACAAAGAACCAAATCGATCACGTAGCTATCAGTAAGACATGGCGCTCTTCTCTTCTTGATGTGCGAAATAAGCGTGGCGCAGACATTGACAGTGATCACCATCTGGTGGTAGCAGAAGTTCGTCTTAAAATAGCAGTTCCCCACAGAAAGCCAGATAAAGCAGCTAGAAAATTTAATATCCGAAAACTGGAAGATAGCAATTGCCGAGAGAAGTTCAGCTTATCTCTCAAAAATAGTTTCGAGCTGCTTAAGGAAATAGAGGATGAGCAGATGGACGAGACGTGGGACCGCATACGTGGTGCTTATAATAAAGCTGCTAAGGAAGTATTGGGGTATACCAATACAAAGCAAGAACCTTGGATGTCAGCAGAGCTTTGGGCAGCCATCGAGAAGAGACAACTTTTGAACACTCAGATTTTAGGCTCCCCTTCAGATGCTATGTTGCGTCGGGAATACTCATCCATGCGATTAGTAATTAGAAAGCTGGCTAGGAGAGATCAGCGAAATGCAATCGATGAGCTAGCAGACCGAGCAAAATTGGCAGCCAAGAGGCAAGATATGAAAGAGCTTTACGATGTCACCAAGCGGATAATAAACAAAAAACATCATCCACGGAAAAAACCACTGAAAGACTGCTCGGGTCAGCTACTATGTACCACGGAAGAGCAGCTCGTGCGCTGGACGGAACACTTTACTAAGTTGCTGTCCAAATGTCAGTCCCAACCGACAGACGGAATATCAGTACCCGACTTGCCTTTGGATATACCTATTGCACCGCCCACCTTTAATGTAAAGTTAATAGTAAAGGCAATTAAACAGCTGAAACCAGGTAAGGCCCCCGGTATTGACAATATCAATGCCGAAATGCTGAAGGCTGATGCACCGAGATCTGCAAGCTTGCTATATCCGCTCATCGTAAGGATTTGGGAGACTGAGCAAATACCGTCTCAATGGAAGCAGGGACTACTCGTGAAAGTTCCGAAGAAGGGCGATTTGTCTTCTTGTGACAACTGGAGAGGCATTACACTTCTTCCTTGCGCAGCAAAGGTCTTGGCTAGATTACTTCTAAACCGGATGTCCAAAAAGATCACTGGAACTCTTCGGGAGGAGCAAGCAGGTTTCTTACCGGGCCGATCATGCACAGACCATACAAACACTCTTCGCATCCTCATAGAACAAAGTGTCGAATGGCAGACTGAAATTATTCTTACGTTTGTAGACTTTGAGAAAGCGTTTGACACTGTACAGTGGAGTAAAATGTGGACCTGCTTAAAACAAAGAGGTATACCAAATAAAATCATTGGTATAATCCAGGCCTTATACAGAGGTAGTACATGTAGAGTCGTGCATGACCAAGTCCTGGGAGCCCCTATTGAGATGACAGCGGGTGTTAAGCAGGGCTGCCTCCTGTCTCCGCTACTATTCATTATGTTACTGGATGACATAATGCGGGAAGTGGTGACGACACCTCGGGGCATTGAATGGAGCGAAAATATCTTGGAAGACCTTGACTATGCAGATGACATAGTGTTGATGACGCCAACTTTGGATCAAATGCAAGCAAAACTTGAAGACCTCCGTATATCTGCGGAGAAAAGAGGCTTGCGTATCAACACCAACAAAACTGTCGACATGCGAGTAATGTCAAAAAACACTACTCCCCTAAAGCTCCAAGACTGTGTGTTGAAGTCAGCACAGAAGTTTACATATCTGGGGAGCTCCATATCAAATCAGGGTGGTTCGGACGAAGATATAGAGATACGAATTAGGAAAGCCAGGGGTGCTTTCGCGCAGTTGAAACCAGTCTGGGAGTCAAGTGTCATGACTCGTCGGATCAAGCTGACCCTGTTCGACTCCATTGTCAAGAGTGTTCTCCTGTTCGGATGTGAGACCTGGAGAGTGACCAAGACACTCACGAACCGACTGCAGGTATTTGTAAATAAGTGCTTGAGGTCGATACTCCGCATATTCTGGCCAGTCACTATCTCTAATAAAGACCTTTGGACTAAATGCGACCAAAATCCCATCGCGCAAGACATTGCTCATCGGAAATGGCGTTGGATAGGACACACTCTACGGCGCAGCGGAGTCAACGCAGCATCAATCGCGTTTGAGTGGCAACCGCTTGGCAGGAGAAGACCTGGTCGCCCTGTACACACTTGGCGACGCACCGTAGAGAGTGAGATGAGGACTGCCAACGTGACCTGGAGTGATGTCAAGGAGCAAACGCAAGACAGAGTAAAGTGGAGACAACTTGTGAGGGCCCTATGTACCAGCGGGGTACCCTAG
Protein
MDWDGLREFYASYPWGRFCFSSADPDVCADRLKDVVLQGMELFIPSSEVPVGGRSRPWYNNASRDAAHLKRSAYVAWDDARRRRDPNISEERRKYNAASRSYKKVIARAKSEHVARIGERLKSYPSGSRAFWSLAKAAEGNFCRSSLPPLRKSDDSLAHSAKEKADLLVKLFASNSTVDDGGATPPNILRCDSSLPEICFTQCAVRRELRLLDVHKSSGPDGIPAVVLKTCAPELTPALTRLYRLSYCANRVPSSWKTAHVHPIPKKGDRSDPSSYRPIAITSLLSKVMERIINIQLLKYLEDRQLISDRQYGFRHGRSAGDLLVYLTHRWAEALESKGEALAVSLDIAKAFDRVWHRALLSKLPSYGIPEGLCKWIASFLDGRSITVVVDGDCSDTMTINAGVPQGSVLSPTLFILYINDMLSIDGMHCYADDSTGDARYIGHQSLSRSVVQERRSKLVSEVENSLGRVSKWGELNLVQFNPLKTQVCAFTAKKDPFVMAPQFQGVSLQPSESIGILGVDISSDVQFRSHLEGKAKLASKMLGVLNRAKRYFTPGQRLLLYKAQVRPRMEYCSHLWAGAPKYQLLPFDSIQRRAVRIVDNPGLTDRLEPLGLRRDFGSLCILYRMFHGECSEELFEMIPASRFYHRTARHRSRVHPYYLEPLRSSTVRFQRSFLPRTIRLWNELPSTVFPERYDMSFFKRGLWRVLSGRQRLGSAPGIAEVHGRRTMTRLERLPQVAKVMQEYNIHILGLSETRWNGFGETQCDFGYSLLYSGKEEDATREYGVGLLLSRSAKSSLLSWKPVSERIICARFSTRVRKVTVIQCYAPTNSASTDVKSQFYEQLGHTLKGIKKQDIVILMGDINAKMGNDNVDREYYMGQYGATGTINENGELFGDLCSTHGLVIGGTLFKHKECHKVTWISPDGKTKNQIDHVAISKTWRSSLLDVRNKRGADIDSDHHLVVAEVRLKIAVPHRKPDKAARKFNIRKLEDSNCREKFSLSLKNSFELLKEIEDEQMDETWDRIRGAYNKAAKEVLGYTNTKQEPWMSAELWAAIEKRQLLNTQILGSPSDAMLRREYSSMRLVIRKLARRDQRNAIDELADRAKLAAKRQDMKELYDVTKRIINKKHHPRKKPLKDCSGQLLCTTEEQLVRWTEHFTKLLSKCQSQPTDGISVPDLPLDIPIAPPTFNVKLIVKAIKQLKPGKAPGIDNINAEMLKADAPRSASLLYPLIVRIWETEQIPSQWKQGLLVKVPKKGDLSSCDNWRGITLLPCAAKVLARLLLNRMSKKITGTLREEQAGFLPGRSCTDHTNTLRILIEQSVEWQTEIILTFVDFEKAFDTVQWSKMWTCLKQRGIPNKIIGIIQALYRGSTCRVVHDQVLGAPIEMTAGVKQGCLLSPLLFIMLLDDIMREVVTTPRGIEWSENILEDLDYADDIVLMTPTLDQMQAKLEDLRISAEKRGLRINTNKTVDMRVMSKNTTPLKLQDCVLKSAQKFTYLGSSISNQGGSDEDIEIRIRKARGAFAQLKPVWESSVMTRRIKLTLFDSIVKSVLLFGCETWRVTKTLTNRLQVFVNKCLRSILRIFWPVTISNKDLWTKCDQNPIAQDIAHRKWRWIGHTLRRSGVNAASIAFEWQPLGRRRPGRPVHTWRRTVESEMRTANVTWSDVKEQTQDRVKWRQLVRALCTSGVP

Summary

Uniprot
ProteinModelPortal
PDB
6AR3     E-value=9.08913e-05,     Score=115

Ontologies

GO

Topology

Length:
1687
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00743999999999999
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00005
outside
1  -  1687
 
 

Population Genetic Test Statistics

Pi
324.250748
Theta
21.776193
Tajima's D
2.550381
CLR
149.717747
CSRT
0.953302334883256
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号