SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03592
Annotation
PREDICTED:_uncharacterized_protein_LOC106708887_[Papilio_machaon]
Location in the cell
Nuclear   Reliability : 1.623 PlasmaMembrane   Reliability : 1.46
 

Sequence

CDS
ATGCTTTGGTTGACAGAACGGATAGGGATGCGGCATTGCTCGATAGGGCATGTATTGTTGGGTCCTGCGTTCCGGCCGGTCGCTGCGAGGAAATCGGACAATTTTCTGGTCGGGTCTACGCTTTCGGAAGTAGTCCAACGGTTTTGGGAACTAGAAGAACCTCCTACAGCTTATCGAGTTAACCCGGATGAGGAGGAATGTGAGCTGTTTTACCAGAATAATACGGGTCGTCTCTATTCGGGCCGGTTCTTGTTAAGACTTCCTTTTCGGGCGAATCGCCCACTGCTAGGCAGTTCGAGGAAGGCAGCAGAGACTAGACTTTTGTCAATGGAGAGACGCATGAGGCGCGACGCGGTGTTCCGTCAGAAATATGTAGAGTTTATGCGGGAGTATGAATCCTTAGGTCACATGTCGGTTTCCAAGGTAGATTGGAGTGCTACGGAGCACTGTTTCCTGCCTCATCATGCGGTTTTGAAAACTCCTAACGGTAAAATTAGGGTCGTGTTTGACGGTTCGGTTACGACCTCCTCCGGCGTCTCGTTAAATCAGTGTCTCCATTCGGGTCCAAAGCTGAACCGGGACATTTCAGACATACTGACGAGCTTCCGCAGGCACCAGATCGTTTTCGTGGCAGACATCCGAATGATGTTCAGGCAAACGGTGATTCATCCGGAGGATAGGCGGTATCAACTCATTCTCTGGCGTGAAAGCTCAGATGAGCCCATAAAAATTTATGAACTGAACACGAACACTTACGGGTTGCGGTCGAGTCCATATTTGGCGGTTCGTTCTTTGCGGGAGCTGGCAGTGAGGGAACGGTTGCACTACCCTCGTGCTGCGGACATTTTGGAACGGGACCTATATGTCGATGACGTATGTACGGGCGCCGACAGTGTCGAAGAGGCCTTATCACGCAAGGATGAACTGATCCGCCTTTTGAGCAGGGGCGGGTACGAGTTGAGAAAATGGCTGTCTAACTGTCCTGAGTTGTTGACTGGTTTGCCAACGGAGTTTCAACAGGATCCCCATCTTTTCGAGAATGTCGATAACCCTAACATGCTGTCGGTCCTAGGGATTCAATATCGTCCGATTCAAGATGAATTTACCTATCGGGTGGAGTTGGAAAATCCAAAGGTATGGTCTAAGCGAACGGTGCTTTCCACAATTGCTCGAACCTTCGATCCAAACGGTTGGATCGCTCCTGTCACTTTTCTCTTAAAGTGCTTCATGCAGCGACTGTGGTCTGCTAACCTGTCATGGGACGAGGGGATTGCTGGTGACCTATTGAAGGATTGGTTGAACTTTTTCTCGTCTCTTCCTGATATTAACCACGTGTCAATACCTCGGAAGCTGGTTCCTGCGGGCAAATACAAGGCGTCTCTCCACGGGTTTTCGGATGCCTCGGAACGCGGATTCGCAGCTGCGGTATACTTGCGAACGGTTTCTTCAACTGGAAGGGTTGATATACGGTTGGTGTTAGCTAAGAGTAAGGTCGCTCCGCTTCGGACACGCATGACCATTCCGAAGCTCGAGTTGTCTGGTGCCGCTCTACTGACTAGGTTGTTAAACCATACAGCTACTAGTTTACGGTCGGTTATTGATTTAGAAAACACTGTGTATGCTTGGACAGACAGCCAGATAGTGTTGTGCTGGTTGAAGGCTTCGGTTCATACACTTGAAGTTTTCGTGGCCAACCGTGTCTCCCAGATTCAAGGATCTGAGGTCCCTCTAACATGGAGACACGTGCCTGGTGAGCTCAATCCGGCGGACTGCGCTTCTCGGGGATGCTTAGCATCGGAAATAGTTGATCATCAGTTATGGTGGGGTCCCCAGTGGCTCACAATGAAGGCTTCTCAGTGGCCACCCTCTCGCATAGGAGTTCCTCCAGGTCTCGTGGCTGCACCGGCGCAGTTCCAGGATCGAGGAGTGATTCAGGGGTTGGATTTGGATCTGCTCATCAACCGTTATAGCTCCTTGGACAAGCTGGTTAAGGTTACCGCCTGGATTTTGAGGTTTATTCGGAATTGTCGTTTGTCGGTGTCTCAACGCAATATGACACCTGTTGTGTGTCCCATCGAGCGGAAGAAGGCACTGCTGAAATTAATTGAAGTTGTGCAAGCCACCAGCTTTCATTCAGAATTGAAGGCGCTAAGGACTGAGCGCCCTAAGCTTCGTGGAGCTATCGCTCGTCTAAGCCCCTTTGTAGACGGCCAGGGGTTGATTCGAGTGGGAGGTAGATTAAGTAACTCCAATTTACCTTATTCGGCGCGCCATCCTCTTTTACTTCCCAAGAAGAGCCAGTTAGTTGACCTGTTGGTGATGGATCGCCACATCGCAAATTCGCATTCCGGTTGCAATGCGCTGCTGGCATCCCTCCAGAGGGAATTTTGGATTCTGTCAGGGCGTCGTACGGTTCGGAGCGTCCTTTTCCGGTGTTTACCCTGTTATCGGCTTAAGGCGTCTACGATGCAGCCTCAGATGGGAGATCTGCCTTCAGACAGAGTGAAGAAGATGAGGCCGTTTTCTGGAGTTGGTACGGACTTCGCTGGGCCCTTCATGATCAAGGCTTCACGTTTGCGGAATGTTAGGTTAATTAAGGCTTATCTGTGCGTCTTTGTCTGTCTTTCAACCAAAGCTGTACATCTTGAAGTTGTTGCCGACCTTACAACTGAAGCCTTTATTGCGAGCTTGGATAGATTTGTGTCCCGTCGAGGTTTACCCGAATTGATACGCTCCGATAACGGAACGAATTTTGTAGGTGCGGACCGTTACTTGCGGGATGTAGTAAATTTCTTGAACAATAACCAGGTGGATATTGAAACGGCCCTCTCTCGTCGCGGTATTCGGTGGACCTTCAGTCCTCCAGGATGCCCCCACTGGGGTGGAATTTTCGAGGCAGTAGTAAAATCGGCTAAGACTCACTTGATGCGCGTGATAGGGCAAACCTCGCTCACCTTTGAGGAGTTAACTACGGTATTTTGTAAAATTGAAGCGGTACTTAATTCGCGGCCGTTGTGCCCGCTCAGTTCAGACCCGAATGACTTGGAGTCGTTAACTCCAGGCCATTTCTTGATAGGACAGCCACTCAATGCGTTGCCGGAGTATCCCCTCTCGGATATCAAGCCTGGACGGTTGAGGCGATACCAGATGTTGCAGCAGATGTCCCAAGATTTTTGGAAACGTTGGTCCCTTGAGTATTTACATCTGCTCCAGCAGCGCTTTAAGTGGACGGATAGAACCAGTCCCCCTCACGTCGGTGACCTTGTGTTGGTTAAGGATGCTAACCTGCCGCCACTGCGTTGGCGTAGGGGGCGCATTGTTAATCTGTTTCCCGGTAAGGATGGGACCCCACGGTCTGCAGAGGTTCTGGTCGGGGACTCGGTTCTCAAACGAGCGGTCACAACGTTGTCCCGGCTGCCAGTTGATTAG
Protein
MLWLTERIGMRHCSIGHVLLGPAFRPVAARKSDNFLVGSTLSEVVQRFWELEEPPTAYRVNPDEEECELFYQNNTGRLYSGRFLLRLPFRANRPLLGSSRKAAETRLLSMERRMRRDAVFRQKYVEFMREYESLGHMSVSKVDWSATEHCFLPHHAVLKTPNGKIRVVFDGSVTTSSGVSLNQCLHSGPKLNRDISDILTSFRRHQIVFVADIRMMFRQTVIHPEDRRYQLILWRESSDEPIKIYELNTNTYGLRSSPYLAVRSLRELAVRERLHYPRAADILERDLYVDDVCTGADSVEEALSRKDELIRLLSRGGYELRKWLSNCPELLTGLPTEFQQDPHLFENVDNPNMLSVLGIQYRPIQDEFTYRVELENPKVWSKRTVLSTIARTFDPNGWIAPVTFLLKCFMQRLWSANLSWDEGIAGDLLKDWLNFFSSLPDINHVSIPRKLVPAGKYKASLHGFSDASERGFAAAVYLRTVSSTGRVDIRLVLAKSKVAPLRTRMTIPKLELSGAALLTRLLNHTATSLRSVIDLENTVYAWTDSQIVLCWLKASVHTLEVFVANRVSQIQGSEVPLTWRHVPGELNPADCASRGCLASEIVDHQLWWGPQWLTMKASQWPPSRIGVPPGLVAAPAQFQDRGVIQGLDLDLLINRYSSLDKLVKVTAWILRFIRNCRLSVSQRNMTPVVCPIERKKALLKLIEVVQATSFHSELKALRTERPKLRGAIARLSPFVDGQGLIRVGGRLSNSNLPYSARHPLLLPKKSQLVDLLVMDRHIANSHSGCNALLASLQREFWILSGRRTVRSVLFRCLPCYRLKASTMQPQMGDLPSDRVKKMRPFSGVGTDFAGPFMIKASRLRNVRLIKAYLCVFVCLSTKAVHLEVVADLTTEAFIASLDRFVSRRGLPELIRSDNGTNFVGADRYLRDVVNFLNNNQVDIETALSRRGIRWTFSPPGCPHWGGIFEAVVKSAKTHLMRVIGQTSLTFEELTTVFCKIEAVLNSRPLCPLSSDPNDLESLTPGHFLIGQPLNALPEYPLSDIKPGRLRRYQMLQQMSQDFWKRWSLEYLHLLQQRFKWTDRTSPPHVGDLVLVKDANLPPLRWRRGRIVNLFPGKDGTPRSAEVLVGDSVLKRAVTTLSRLPVD

Summary

EMBL
GEBQ01022991    GEBQ01006185    JAT16986.1    JAT33792.1    GEBQ01007199    GEBQ01000222    + More
JAT32778.1    JAT39755.1    ABLF02005684    GEZM01085145    GEZM01085143    JAV60187.1    LBMM01009888    KMQ87813.1    GGMR01014165    MBY26784.1    LNIX01000007    OXA51795.1    ABLF02039606    LNIX01000016    OXA46198.1    LNIX01000036    OXA39969.1    JXUM01030959    KQ560903    KXJ80414.1    LNIX01000069    OXA36894.1    GDHC01006469    JAQ12160.1    GBHO01044317    GBHO01044315    JAF99286.1    JAF99288.1    GEZM01054765    JAV73413.1    GBHO01034065    GBHO01034061    JAG09539.1    JAG09543.1    GBHO01038805    GBHO01038804    GBHO01038801    JAG04799.1    JAG04800.1    JAG04803.1    GEZM01018702    JAV90048.1    ABLF02030698    ABLF02030705    ABLF02030709    ABLF02021785    ABLF02030854    ABLF02067347    GALX01004947    JAB63519.1    ABLF02006304    ABLF02036268    ABLF02054908    LNIX01000002    OXA60848.1    ABLF02035780    GGMS01009443    MBY78646.1    LBMM01009202    KMQ88311.1    GGMR01010723    MBY23342.1    OXA59522.1    GEZM01060254    JAV71154.1    ABLF02001506    ABLF02008029    ABLF02035899    ABLF02037719    ABLF02046327    ABLF02064627    LBMM01009964    KMQ87756.1    ABLF02028666    ABLF02066713    LBMM01010405    KMQ87487.1    LBMM01009551    KMQ88039.1    ABLF02041614    LBMM01012188    KMQ86362.1    KK114194    KFM61875.1    LBMM01009898    KMQ87805.1    LBMM01009746    KMQ87900.1    LBMM01009645    KMQ87967.1    GBHO01044316    JAF99287.1    GGMR01005823    MBY18442.1    LBMM01006490    KMQ90572.1    LBMM01008464    KMQ88855.1    GGMR01002024    MBY14643.1    GGMR01016460    MBY29079.1    GBRD01007977    JAG57844.1    GGMS01014951    MBY84154.1    GBHO01023090    JAG20514.1    LBMM01009688    KMQ87939.1    ABLF02015138    ABLF02008636    ABLF02065931    GGMR01013370    MBY25989.1    GGMR01002187    MBY14806.1    ABLF02004035    ABLF02004036    ABLF02004037    ABLF02004038    ABLF02008018    ABLF02008020    ABLF02012635    ABLF02061171    GEBQ01000825    JAT39152.1    GEBQ01015458    JAT24519.1    ABLF02008594    ABLF02022040    ABLF02056888    GGMR01006575    MBY19194.1    GGMS01012379    MBY81582.1    GGMS01010524    MBY79727.1    GFTR01008866    JAW07560.1    GGMR01003717    MBY16336.1    GEZM01066272    JAV68024.1    LNIX01000005    OXA54454.1    LBMM01010417    KMQ87475.1    GBHO01007689    JAG35915.1    ABLF02023842    ABLF02028949    ABLF02058391    GGMR01002421    MBY15040.1    GDHC01006567    JAQ12062.1    LBMM01007859    KMQ89359.1    GGMR01020500    MBY33119.1    GDHC01002235    JAQ16394.1    ABLF02041650    GBBI01004479    JAC14233.1    GGMR01017890    MBY30509.1    GEZM01021505    JAV88969.1    ABLF02067195    GDHC01014057    JAQ04572.1    ABLF02003736    ABLF02008292    ABLF02008294    ABLF02046909    ABLF02052378    ABLF02036131    ABLF02041527    ABLF02064049    GGMR01018506    MBY31125.1    GFTR01008874    JAW07552.1    GGMR01005535    MBY18154.1    ABLF02006784    GGMR01018294    MBY30913.1    GEHC01000869    JAV46776.1    KQ973442    KXZ75531.1    GL769615    EFZ10365.1    ABLF02025193    ABLF02013940    ABLF02036313    ABLF02066938    ABLF02066950    GGMR01014306    MBY26925.1    LBMM01005079    KMQ91831.1    LNIX01000018    OXA45284.1   
Pfam
PF03564   DUF1759        + More
PF18701   DUF5641
PF00665   rve
PF05380   Peptidase_A17
PF17921   Integrase_H2C2
PF05585   DUF1758
PF00078   RVT_1
PF17919   RT_RNaseH_2
PF17917   RT_RNaseH
PF09337   zf-H2C2
Interpro
IPR005312   DUF1759        + More
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR008737   Peptidase_asp_put       
IPR040676   DUF5641       
IPR012337   RNaseH-like_sf       
IPR008042   Retrotrans_Pao       
IPR001584   Integrase_cat-core       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001878   Znf_CCHC       
IPR001995   Peptidase_A2_cat       
IPR001969   Aspartic_peptidase_AS       
IPR000477   RT_dom       
IPR041373   RT_RNaseH       
IPR041577   RT_RNaseH_2       
IPR036875   Znf_CCHC_sf       
IPR000727   T_SNARE_dom       
IPR015416   Znf_H2C2_histone_UAS-bd       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
1142
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.02553
Exp number, first 60 AAs:
0.02169
Total prob of N-in:
0.00118
outside
1  -  1142
 
 

Population Genetic Test Statistics

Pi
171.5117
Theta
128.81811
Tajima's D
-0.550508
CLR
0.530318
CSRT
0.229138543072846
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号