SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03590
Annotation
hypothetical_protein_[Piscirickettsia_salmonis]
Location in the cell
Mitochondrial   Reliability : 1.2 Nuclear   Reliability : 1.249
 

Sequence

CDS
ATGCGTCGCGTCTGCGATGCTGCGATGCCCCGGGTCAGCGGTCGCGCTCCGCGTGGCGGTGCGTATTGGTGGACGCCCGAGATCGCGCTCCTCCGAGAGGAGTGCGTGCGGGCGCGCCGCCGAAGCGCCCGCCACCGCCGTCGCCGCCTTCGCGATGCGGACTTCGCGGAGGTGGCGACCCGCCTGCATGCCGACTGCCGTCAGAAGCAGGAGGCACTGCGGCGGGCCATCGGCGAGGCCAAGTCTCAGAGCATGAAGACGCTCCTGGAGACGCTTGACCAAGATCCTTGGGGGCGCCCGTACCAAACGGTCCGCAAGAAATTGCGGCCGTGGGCGCTCCCGGTGACGGAACGTCTCCAGCCTCAGCAGCTGCGGGAGATTGTCTCCGGGCTGTTCCCGCGGATGGAGAGGGGCTTCGAGCCCCCTTCCATGGGCGCGCCACCACGCAGTAGCGTGAGCGGTGATGCCCCTGCTGAGGTGGTCCCTCCGAGCATCTCGGAGGAGGAGATTCGTGCGGCCGTGTCGAGGATGCGGAGGAAGGACGCGGCCCCCGGCCCTGACGGTGTTCACGGCCGGGTCTGGGATTTGGCCTTCGGTGCCCTTGGGGACCGACTCGTGCGGCTCTATGAAGCCTGCCTCGAGTCGGGACGGTTTCCGAAGCAGTGGAAGACGGGCAGACTTGTTCTGCTAAGGAAGGAGGGACGCCCCGCGGACTCACCTGCGGGATATCGTCCCATCGTGCTGCTGGACGAGGCTGGAAAATTGCTCGAGCGGGTGGTGGCCGCCCGCATCGTCCAGCATCTGACGGGGGTGGGTCCCGATCTGTCAGCGGAGCAGTTCGGATTCAGGGAGGGCCGCTCGACCATCGACGCGGTGATGCGCGTGCGTGCCCTCTCTGATGAGGCTGTCGGCCAGGGCGGGGTTGCACTGGCGGTGTCCCTTGACATCGCCAACGCGTTCAACACCTTGCCCTGGTCGGTGATCGCAGGGGCGCTGGAGTATCACGGCGTCCCTGCGTATCTCCGTCGGCTGATCGGGTCCTACCTCGAGGACAGGTCGGTCGTGTGCACCGGGCACGGTGGGGCGGTGCTCCGCTTCCCCGTCCAGCGCGGTGTTCCACAGGGGTCGGTCCTTGGCCCTCTCTTGTGGAACATCGGCTACGACTGGGTCCTGCGTAGCGCCCTAAGTGCTCCTCTTCCGGGTCTGAGCGTAGTTTGTTACGCGGACGACACTTTGGTCGTGGCCCGGGGGAGGGACTTGCGAGAGTCTGCCCGTCTTTCCTGCGCGGGGGTGGCCTTCGTCATCGGCAGGATCCGAAGGCTGGGTCTGGAGGTGGCGCTCGATAAATCCCAGGCCCTGTTGTTTCACGGGGCCCGGAGAGCGCCGCCTCAGGGGGCCCACCTCGTGATCGGAGGCGTTCGCGTCGAGATCGAGGCAACCGGGTTGCGGTACCTCGGTCTCGTACTGGACGGTCGTTGGAGCTTCCGCGCTCACTTTGAAAGATTAGGTCCCCGACTGATGGCGGCTGCCGGCTCGCTGAGTCGGCTGTTGCCGAACGTCGGGGGGCCTGACTTGGTGGTGCGCCGCCTCTACACGGGGGTGGTGCGGTCGATGGCACTGTACGGGGCTCCCGTGTGGTGCCACGCCCTGACCCGCGACAACGTTGCGGCGTTGCGACGTCCGCAGCGCGCGATTGCGGTCAGGGCGGTTCGTGGATACCGCACCGTCTCGTTTGAGGCGGCGTGCGTGCTAGCTGGGACGCCTCCCTGGGACCTGGAAGCGGAGGCGCTCGCTGCGGATTACGCGTGGCGATGCGATCTCCGCTCCAGGGGGGAGCCGCGTCCCGGCGCGGCGGAAGTTCGAGCGCGGAAGCTTCAATCTCGGCGTGCCGTGCTCGAGGCGTGGTCTCGCCGCCTGGCGGACCCCGCCTACGGGCGACGGACCGTCGAGGCGATCCGCCCGGTCCTCTCGGAATGGGTGAATCGCGACCGAGGACGTCTCACCTTCCGAGCGACACAGGTGCTCACGGGACACGGCTGTTTCGGTCGCTACCTGCACCTCGTCGCCCGGAGGGAGCCGACGCCGAAGTGCCACCACTGCAGTGGCTGCAACGAGGACACGGTGGAGCACACGCTCGCGTACTGCACCGCTTTCGCGGAGCAGCGCCGCGTCCTCGTTGCAAAAATAGGACCGGACTTGTCGCTTCCGACCGTCGTGGCTACGATGCTCGGCAGCGACGAGTCCTGGCAGGCGATGCTCGACTTCTGCGAGTCCACCATCTCGCAGAAGGAGGCGGCGGAACGGGAGAGGGAGAGCTCTTCTTCCCTCTCGGCGCCGTGCCGCCGCCGTCGAGCCGGGGTTCGGAGGAGGGCGTTTGTCCAGCTCCAGCCCCTATGA
Protein
MRRVCDAAMPRVSGRAPRGGAYWWTPEIALLREECVRARRRSARHRRRRLRDADFAEVATRLHADCRQKQEALRRAIGEAKSQSMKTLLETLDQDPWGRPYQTVRKKLRPWALPVTERLQPQQLREIVSGLFPRMERGFEPPSMGAPPRSSVSGDAPAEVVPPSISEEEIRAAVSRMRRKDAAPGPDGVHGRVWDLAFGALGDRLVRLYEACLESGRFPKQWKTGRLVLLRKEGRPADSPAGYRPIVLLDEAGKLLERVVAARIVQHLTGVGPDLSAEQFGFREGRSTIDAVMRVRALSDEAVGQGGVALAVSLDIANAFNTLPWSVIAGALEYHGVPAYLRRLIGSYLEDRSVVCTGHGGAVLRFPVQRGVPQGSVLGPLLWNIGYDWVLRSALSAPLPGLSVVCYADDTLVVARGRDLRESARLSCAGVAFVIGRIRRLGLEVALDKSQALLFHGARRAPPQGAHLVIGGVRVEIEATGLRYLGLVLDGRWSFRAHFERLGPRLMAAAGSLSRLLPNVGGPDLVVRRLYTGVVRSMALYGAPVWCHALTRDNVAALRRPQRAIAVRAVRGYRTVSFEAACVLAGTPPWDLEAEALAADYAWRCDLRSRGEPRPGAAEVRARKLQSRRAVLEAWSRRLADPAYGRRTVEAIRPVLSEWVNRDRGRLTFRATQVLTGHGCFGRYLHLVARREPTPKCHHCSGCNEDTVEHTLAYCTAFAEQRRVLVAKIGPDLSLPTVVATMLGSDESWQAMLDFCESTISQKEAAERERESSSSLSAPCRRRRAGVRRRAFVQLQPL

Summary

Similarity
Belongs to the AB hydrolase superfamily. Lipase family.
EMBL
AB090825    BAC57926.1    AB078935    BAC06462.1    AB078931    BAC06456.1    + More
AB078929    BAC06452.1    AB078930    BAC06454.1    LBMM01012027    KMQ86470.1    KZ149896    PZC78733.1    D85594    BAA19776.1    LBMM01006671    KMQ90407.1    LBMM01006954    KMQ90166.1    LBMM01008448    KMQ88867.1    LBMM01007036    KMQ90099.1    LBMM01004272    KMQ92618.1    LBMM01006657    KMQ90417.1    LBMM01015565    KMQ84759.1    LBMM01002052    KMQ95336.1    LBMM01007425    KMQ89740.1    LBMM01002480    KMQ94776.1    LBMM01015018    KMQ84954.1    LBMM01004505    KMQ92346.1    LBMM01005948    KMQ91066.1    LBMM01004634    KMQ92224.1    LBMM01015025    KMQ84953.1    LBMM01012412    KMQ86235.1    LBMM01003988    KMQ92922.1    LBMM01006063    KMQ90967.1    LBMM01005733    KMQ91252.1    LBMM01008278    KMQ89009.1    LBMM01008422    KMQ88894.1    ABLF02015311    ABLF02015320    ABLF02034009    ABLF02043484    LBMM01014122    KMQ85315.1    ABLF02011238    GGMR01015159    MBY27778.1    GGMR01000779    MBY13398.1    LBMM01005474    KMQ91485.1    LBMM01004262    KMQ92649.1    KU543683    AMS38371.1    GGMR01014195    MBY26814.1    LBMM01003245    KMQ93755.1    LBMM01015285    KMQ84870.1    LBMM01004261    KMQ92650.1    GFXV01002090    MBW13895.1    GAMC01020519    GAMC01020515    JAB86040.1    GAMC01020517    JAB86038.1    GGMR01011682    MBY24301.1    LBMM01005216    KMQ91703.1    GFXV01003903    MBW15708.1    LBMM01008445    KMQ88871.1    KMQ94772.1    ABLF02034925    LBMM01013668    KMQ85535.1    ABLF02041886    GGMR01006838    MBY19457.1    LBMM01005465    KMQ91492.1    GGMR01004600    MBY17219.1    ABLF02004674    ABLF02004675    ABLF02004676    ABLF02011637    ABLF02021100    ABLF02013358    ABLF02013361    ABLF02054869    GALA01001777    JAA93075.1    GAKP01002292    JAC56660.1    ABLF02041557    GEHC01000964    JAV46681.1    AJ278684    CAB99192.1    GGFK01005660    MBW38981.1    ABLF02023257    AB090815    BAC57906.1    GGFL01001583    MBW65761.1    ABLF02059310    GGFJ01001369    MBW50510.1    GGFJ01001727    MBW50868.1    KQ971309    EEZ99146.1    QOIP01000014    RLU15074.1    GAPW01000192    JAC13406.1    GEHC01000915    JAV46730.1    GGFJ01001370    MBW50511.1    GALA01001776    JAA93076.1    GALA01000302    JAA94550.1    GGFJ01001439    MBW50580.1    ABLF02014378    LBMM01008226    KMQ89040.1    AB593321    BAK38639.1    ABLF02007989    LBMM01006977    KMQ90149.1    KQ972226    KYB24577.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF01553   Acyltransferase
PF03372   Exo_endo_phos
PF00098   zf-CCHC
PF00151   Lipase
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR002123   Plipid/glycerol_acylTrfase       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR029058   AB_hydrolase       
IPR013818   Lipase/vitellogenin       
IPR000734   TAG_lipase       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
SSF53474   SSF53474       
Gene 3D
PDB
6AR3     E-value=2.2354e-05,     Score=117

Ontologies

Topology

Subcellular location
Secreted  
Length:
798
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0222199999999999
Exp number, first 60 AAs:
0.00091
Total prob of N-in:
0.00070
outside
1  -  798
 
 

Population Genetic Test Statistics

Pi
33.085843
Theta
23.234107
Tajima's D
-1.343069
CLR
0.75565
CSRT
0.0781960901954902
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号