SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03587  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA006313
Annotation
heat_shock_protein_70-4_[Melitaea_cinxia]
Full name
Heat shock protein 68       + More
Heat shock 70 kDa protein cognate 2      
Alternative Name
Heat shock 70 kDa protein 87D
Location in the cell
Cytoplasmic   Reliability : 2.768
 

Sequence

CDS
ATGGTACCAGCTGTTGGAATAGATCTGGGAACAACATATTCCTGCGTGGGAATCTTCCAGCACAGCAAAGTGGAAATCATAGCTAACGACCAAGGTAACAGAACAACACCATCTTACGTCGCTTTTACTGAGACAGAGAGATTAATTGGAGATCCTGCGAAGAACCAGGTGGCGATGAACCCAAAGAACACAGTTTTTGATGCTAAACGCCTCATCGGACGTAAATTCGGTGATCCAAAAGTACAACAAGACATAAAGCATTGGCCTTTTCAAGTTATTTCGGAAGGTGGTGAACCAAAAATTGTCGTCGAATATAAAGGGGATACAAGGAAATTCGCTCCTGAAGAGATATCTTCAATGGTTTTAACGAAAATGAAAGAAATTGCTGAAAAGTTTCTGGGTGGCGTCGTAAATGATGCAGTCATCACTGTACCGGCTTATTTTAATGATTCTCAGCGTCAAGCTACAAAAGATGCCGGTGTTATCGCTGGCTTAAACGTTCTTAGAATCATCAACGAGCCAACAGCAGCAGCTCTAGCCTATGGACTGGACAAAAATTTAAAAGGTGAAAGAAATGTTTTGATATTTGACCTTGGCGGAGGGACTTTTGATGTTTCAGTACTTCAAATATCTGAAGGATCTCTATTTGAAGTAAAATCAACAGCTGGAGACACACATTTGGGTGGTGAAGACTTTGATAGCCGAATGGTAGATCATTTTTGTCAAGAGTTTGAAAAGAAATACAAAAGAAAAATTAAAGAAAATCCTAAAGCTTTAAGAAGACTTCGTACCGCTTGCGAAAGATGTAAAAGAACATTATCTTCAAGTACTGAAGCCAGTATAGAAATAGATGCATTACACGATGGTATAGATTTCTATTCTAAACTGTCAAGGGCTCGCTTTGAAGATTTATGTTCGGACTTGTTCAGACAAACTCTTGAACCAGTCGAACAAGCCCTAAAAGATGCAGGATTCAATACAAGAGAAATACACGATGTTGTCATGGTGGGAGGCTCTACTAGAATACCAAAAATCCAACGATTATTGCAGGATTTCTTTGGTGGTAAAACGCTAAATATGTCCATCAATCCAGACGAAGCTGTAGCGTACGGAGCCGCAGTGCAAGCAGCCATTCTCACTGGTAGCAAAGACACACGTATTCAGGATGTGCTCCTTGTTGATGTGATCCCATTGTCTCTCGGTATTGAGACTGCTGGGGGTGTCATGACACGCTTGGTAGACAGGAACTCAACGATACCTACCACACAGAAGAAAATTTTCACCACATACGCTGATAACCAACCTGCTGTGACTATTCGGATTTACGAAGGGGAACGTGTTCTGACCAAAGATAACAACCTTTTGGGTACATTTAATTTGTCTGGAATACCACCAGCTCCAAGAGGAGTACCACAAATAGAGGTAACTTTCGATGTAGATGCCAATGGCATCCTCAATGTTAGCGCTGAAGATAGAAGCACTGGTCGTTCGGAGAACATTACAATTTCAAATGACAAGGGCCGTCTTAGTAAACAGGACATTGAAAATATGCTTAGAGACGCGGAGAAGTTTAAAGCCGAGGATGAAGCTATAAAAAAGGGAGTTGAATCGAGAAACCGACTAGAGGGATACCTTTTTGGATGTAAAGCAGCAGTCGAAAACGCCGGTGAGAGACTGACAGAAACCGAAAAGAACGCAGTTATAACAGAATGCAGTGCCCAGCTGCGATGGCTGGAAGCCAATCCTGACGCGCCAGAAGCACAAACCGAGCAACGCCTCAAGGACGCCCAGAGAGTCTGCCAACCGGTGATGATGAAACTCCATGGAGCTGGAGGAGCCGGCGCTAGACCTGCTACTTCTGATGGACCGAGGGTTGAAGAAGTTAATTAA
Protein
MVPAVGIDLGTTYSCVGIFQHSKVEIIANDQGNRTTPSYVAFTETERLIGDPAKNQVAMNPKNTVFDAKRLIGRKFGDPKVQQDIKHWPFQVISEGGEPKIVVEYKGDTRKFAPEEISSMVLTKMKEIAEKFLGGVVNDAVITVPAYFNDSQRQATKDAGVIAGLNVLRIINEPTAAALAYGLDKNLKGERNVLIFDLGGGTFDVSVLQISEGSLFEVKSTAGDTHLGGEDFDSRMVDHFCQEFEKKYKRKIKENPKALRRLRTACERCKRTLSSSTEASIEIDALHDGIDFYSKLSRARFEDLCSDLFRQTLEPVEQALKDAGFNTREIHDVVMVGGSTRIPKIQRLLQDFFGGKTLNMSINPDEAVAYGAAVQAAILTGSKDTRIQDVLLVDVIPLSLGIETAGGVMTRLVDRNSTIPTTQKKIFTTYADNQPAVTIRIYEGERVLTKDNNLLGTFNLSGIPPAPRGVPQIEVTFDVDANGILNVSAEDRSTGRSENITISNDKGRLSKQDIENMLRDAEKFKAEDEAIKKGVESRNRLEGYLFGCKAAVENAGERLTETEKNAVITECSAQLRWLEANPDAPEAQTEQRLKDAQRVCQPVMMKLHGAGGAGARPATSDGPRVEEVN

Summary

Similarity
Belongs to the heat shock protein 70 family.
Keywords
ATP-binding   Complete proteome   Nucleotide-binding   Phosphoprotein   Reference proteome   Stress response   3D-structure  
Feature
chain  Heat shock protein 68
EMBL
BABH01025997    JX680680    AGR84227.1    JX680675    AGR84222.1    AGBW02009711    + More
AGBW02009470    OWR50052.1    OWR50749.1    KZ149893    PZC78955.1    NWSH01000409    PCG76604.1    KQ459249    KPJ02391.1    KQ460647    KPJ13200.1    ODYU01010110    SOQ54985.1    MG265914    AXU24970.1    GBHO01003216    GBRD01005544    JAG40388.1    JAG60277.1    GECL01003413    JAP02711.1    GFTR01007533    JAW08893.1    KF214746    AHF52926.1    KM221884    AIU47025.1    GBGD01000817    JAC88072.1    CM000070    EAL27638.1    HM141537    ADJ96611.1    GEDC01000605    JAS36693.1    GFXV01004822    MBW16627.1    ABLF02025583    KU050681    ANA11230.1    GEZM01086566    GEZM01086565    JAV59244.1    HM370511    ADK94699.1    GGMR01009026    MBY21645.1    KY705383    ARW29609.1    JX678981    AFU06382.1    GAKP01020060    JAC38892.1    JQ693014    AFQ37587.1    EF103584    ABL06948.1    KU159184    AMX23517.1    HM370510    ADK94698.1    HM370509    ADK94697.1    JXJN01015479    KY661325    AVA17412.1    KQ971316    EEZ97821.1    GEBQ01026193    JAT13784.1    KU516012    AMK38874.1    KP994341    AMD09927.1    CH940652    EDW59304.1    AF096275    AE014297    AY094878    CCAG010000199    GDHF01004711    JAI47603.1    CH954182    EDV53921.1    KY457331    ASA47799.1    GAKP01020061    JAC38891.1    JX112893    AFP54305.1    CH480815    EDW43425.1    FJ177310    ACJ64194.1    JRES01000232    KNC33132.1    KU932402    APA34038.1    HQ012004    ADV03160.1    AJWK01021311    JQ711194    AFQ33498.1    GAKP01020059    JAC38893.1    BT016141    K01297    K01296    CVRI01000010    CRK88906.1    KQ458671    KPJ05577.1    DQ311189    ABD36134.1    FJ177309    ACJ64193.1    CRK88904.1    AGBW02009614    OWR50325.1    JQ693015    AFQ37588.1    JQ782193    AFJ20626.1    JF836794    AEI58996.1    KY930331    ATL76715.1    GDHF01000126    JAI52188.1    GBBI01002050    JAC16662.1    EDW42365.1    CH916369    EDV93054.1    GDHF01008621    JAI43693.1    GEDV01012639    JAP75918.1    KC544270    AHA36970.1    EZ423171    ADD19447.1    JN863695    AFK93490.1    GEDC01012328    JAS24970.1    GEDC01011580    JAS25718.1    AGBW02009136    OWR51575.1    KK853289    KDR08926.1    AB035326    BAF69068.1    EDV93244.1    GECU01013428    GECU01000754    JAS94278.1    JAT06953.1    HM769899    ADL27420.1    JN863694    AFK93489.2    GBXI01013546    JAD00746.1    FJ177311    ACJ64195.1    GAKP01020058    JAC38894.1   
Pfam
PF00012   HSP70
Interpro
IPR018181   Heat_shock_70_CS        + More
IPR029048   HSP70_C_sf       
IPR013126   Hsp_70_fam       
IPR029047   HSP70_peptide-bd_sf       
SUPFAM
SSF100934   SSF100934        + More
SSF100920   SSF100920       
Gene 3D
PDB
5FPN     E-value=0,     Score=2127

Ontologies

Topology

Length:
629
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01388
Exp number, first 60 AAs:
0.00294
Total prob of N-in:
0.00045
outside
1  -  629
 
 

Population Genetic Test Statistics

Pi
241.907965
Theta
217.086287
Tajima's D
0.433418
CLR
0
CSRT
0.494575271236438
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
20518026 GANKCFSPEEISSMVLTK 100.00 3e-06
20518026 FAPEEISSMVLTK 100.00 3e-06
20518026 DAGAIAGLNVLR 100.00 3e-04
20518026 DAGAIAGINVLR 100.00 3e-04
25044914 IFTTISTAIIK 100.00 6e-04
26280517 DATTIGYIDADTAIIKDNIK 100.00 6e-04
28556443 ASNGDAWVQGTDGK 100.00 0.003
28556443 IINEPTAAAIAY 100.00 0.003
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号