SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03582
Pre Gene Modal
BGIBMGA011165
Annotation
PREDICTED:_uncharacterized_protein_LOC106709547_[Papilio_machaon]
Full name
Galactose-1-phosphate uridylyltransferase      
Location in the cell
Mitochondrial   Reliability : 1.547 Nuclear   Reliability : 1.797
 

Sequence

CDS
ATGTCTCAAGAAATCTACAGAGTTGGTGTGCGCATTCCGCCATTCTGCTCAGAGGACCCAGAAATGTGGTTTAGTCAGATAGAGATGCAATTTAAGCTCTCAGGGATATCGGTGGACGATACTAAGTTTACGTATGTGTCAGCGAACCTGGAACCACAATATGCCAAGGAGGTGAGAGACATCATAACTAAACCGCCAGCTTCAAATAAATACGAAAAACTCAAAACAGAGCTGATCAAGCGACTATCTATATCACAGGAGAAGCGTGTAAGACAACTTCTCATGCACGAAGAACTCGGAGATCGTAAACCGTCTCAGTTTCTACGCCACTTGACAAGTCTAGCTGGTTCAGACGTTCCATCTGATTTTATAATAACCATCTGGACCAGTCGTCTGCCTGTGAACGTGCAAACAGCAGTCGCTACGATTAAAGGATCGCCAATGGAAAAGCTGAGTGACTTGGCAGATGTCGTATACGAAATGGCCCCAGCAGTACCACAGGTGGCAAGCGCGTCTTCCCAAGCCCAAGGCAATGAGCAAGTCAATCCGACACTGACCATGCAGTTTCGCGTCGGAAAACTCCTGGGGCGGTCGGAAGTAGCGGCCAACGACTGCCCACATTCTTCAGGCCGTCTTTTTATCACCGACCGTACTTCAAAAATGCAGTTCCTAGTGGATACTGGTTCCGATCTGTGTGTTTTTCCACGGTCGGCTGTGAAGGCGCCCTGTACCAAGTCGAAATATGATCTCGTAGCCGCGAATAATTCTATTATACACACTTATGGCCCTGTAACTCTTCATTTGGACTTTGGACTAAGAAGAGACTTCGCGTGGAAATTCACTGTTGCAGACGTATCTAAGCCCATAATCGGAGTGGATTTCTTGTCTTACTACAACTTACTCGTCGATTGCAGAAAACAGCGTATCATTGATGGCATCACTTCTCTGTCTGCAGTCGCGACACCTATCGGGATGACTAAAGACCTTCCTTCTGTCAAAGCCGTCACTGGTGAAACTGACTTCCACGATATTCTGCGAGAGTTCCCAGAAATCACAAGGCCAGCAGGTATGCTCTCTACCACATTTAAGCATAACACCGTTCATCATATTAGAACTACACCGGGACCTCCCGTTGCTTGCAAGCCTCGACGTTTGGATCCAGCACGTATGCAAGCCGCGAAGAAAGAGTTCGAGGATATGTTGGCAAGCGGCGTAGCCCGGCGTTCAGAGAGTGCATGGTCTTCTGCTCTGCACTTGGTGAAGAAGAAATATGATGGATGGCGTCCTTGTGGCGATTACCGATCACTGAATGCGAGGACGATACCTGATAGGTATCCAATACGCCACATCCATGACTTCTCACAACAACTTTCTGGATGTTCCATCTTTTCTAAAATTGATTTGGTGAAGGCTTATCATCAGATAGCCGTTAATCCTGAGGATATACCTAAAACAGCCATCACTACTCCTTTTGGACTTTACGAATTTCCATTTATGACCTTTGGTTTGAGGAATGCCGCTCAGACATTCCAAAGGTTCATAGATGAGGTGCTACTAGGCTTCGACTTCACCTATGGATATATTGATGATATATTATTGTTTTCTTCATCGCTAGAAGAACATAAGCGTCATCTACGTCAACTCTTTGATCGTCTCCGGCAGTATGGCATTTTGGTGAACACAACAAAATGTACTTTTGGTCAATCGGTCGTGGAATTCCTAGGATATGAAGTATCTGCTACAGGTACTAAACCATTGGACACTAAAGTCCAAGCTATCCAGGAATTTGCTGCTCCCAAGACTGTGAAAGAACTCCGAAGATTCTTAGGCATGCTTAATTTCTACCGACGTTTCATACCTAATGCCGCCCAGTTACAAGCTCCGTTGAACAACGCTCTGGCAGGAGTTAAAATGAAAGGTTCACATCCTGTGGATATGGATACAGTCATGTTAAAAGCCTTTGAGGATTGTAAGACTTCTTTATCTCAGGCAACGCTTTTGTCTCACCCGGATCCAACCGCCGATCTTGCGATTGTCACTGACGCGTCTCTCACAGCGATCGGAGCTGTTCTACAACAAAGGAGAGGTGAACATTGGGAACCACTCGCTTTCTACTCCCACAAGCTTAGTTCCACCCAATCGAAGTACAGTCCATATGATCGAGAATTACTGTCAGTTTATGAGGCAATAAAGCATTTTCGACACATGATCGAAGCAAGAAATTTCACCATCTTCACTGATCATAAACCACTGACTTTTGCCTTCTCAGTAAACAGGGAGAAATGTTCACCAAGGCAATTCAGATATCTCGACTACATATCGCAGTTTACTACGGATATTAAATATATACCTGGAAAGGATAACGTAGTCGCCGACGCACTTTCTCGGGTGGATGAAGTCGCTCCATGTATCGACTATGAACGTCTTGCACGGTCTCAGGAACAAGATCCAGAGCTGCAAGATCTTCTGCGTAATGGAAGTTCTCTAAAATTAGAAAGTTATCTTCTGAGTATAGTAGCTTACCCGTTTATTGCGACACCAGTGTGCACCCTCCACGACCATTCATCACAAAAGATATGCGAAGACAAGTCTTCAACACACTGCATGGACTTCATCACCCAGGATCGTCAGCTACAGTCCGACTGGTACTGCCTCACTGTTATTGACCGCTTCACCCGATGGCCTGAGGCGATACCACTCAGCGAAATTACAGCTGAAGCTTGTGCTGCCGCCCTCGTTACCGGCTGGATTGCCAGATTTGGATGTCCACTGAGGGTGACTACCGACCGTGGTCGTCAATTCGAGAGCCACTTATTCAAAGCCATAGCTGCATTAATAGGTGCTCACCACTTCCGGACTACCGCATATCACCCCGCCGCCAACGGAATAGTCGAACGAATGCATCGCCAGTTGAAGGCAGCCATCATGTGCCATACATCTTCGCAATGGACTGAAGCACTTCCTCTAGTACTGATGGGCATGCGCAGTTCCTGGAAGGATGACATTGACGCATCTCCTGCAGAGCTGGTGTACGGCGAGCCCCTCTGTCTGCCAGGTCAATTCATTTCACCAAATGAAGATTACAAAGTGTCTGACGTCACCCAGTATGCAACTCGTCTACGTGCATGCATGGCGAATTTGACACCGAGACCGACATCCTGGCATAGCAATTCACCATTTTATATACCTCGCGATTTACATACAACCTCCCATGTCTTCATCCGACAAGATCATGTGCGTGGTTCTCTGGTACCACCATATGCTGGTCCCTTCAAGGTTGTCAAAAGGCAGCCAAAATTTTTCACTGTCGAAGTTCGAGGGAAGCTTGTAAATGTCTCCATAGATCGTCTGAAGCCGGCCTACATGACGAGAGTCCCAGAAGGTGTGTCTCCAACCAAGCCTGTTGAAAAGACTACAAGAAGCGGCCGAAAGATTAAACTGCCTGATTACTATCGACCGTAG
Protein
MSQEIYRVGVRIPPFCSEDPEMWFSQIEMQFKLSGISVDDTKFTYVSANLEPQYAKEVRDIITKPPASNKYEKLKTELIKRLSISQEKRVRQLLMHEELGDRKPSQFLRHLTSLAGSDVPSDFIITIWTSRLPVNVQTAVATIKGSPMEKLSDLADVVYEMAPAVPQVASASSQAQGNEQVNPTLTMQFRVGKLLGRSEVAANDCPHSSGRLFITDRTSKMQFLVDTGSDLCVFPRSAVKAPCTKSKYDLVAANNSIIHTYGPVTLHLDFGLRRDFAWKFTVADVSKPIIGVDFLSYYNLLVDCRKQRIIDGITSLSAVATPIGMTKDLPSVKAVTGETDFHDILREFPEITRPAGMLSTTFKHNTVHHIRTTPGPPVACKPRRLDPARMQAAKKEFEDMLASGVARRSESAWSSALHLVKKKYDGWRPCGDYRSLNARTIPDRYPIRHIHDFSQQLSGCSIFSKIDLVKAYHQIAVNPEDIPKTAITTPFGLYEFPFMTFGLRNAAQTFQRFIDEVLLGFDFTYGYIDDILLFSSSLEEHKRHLRQLFDRLRQYGILVNTTKCTFGQSVVEFLGYEVSATGTKPLDTKVQAIQEFAAPKTVKELRRFLGMLNFYRRFIPNAAQLQAPLNNALAGVKMKGSHPVDMDTVMLKAFEDCKTSLSQATLLSHPDPTADLAIVTDASLTAIGAVLQQRRGEHWEPLAFYSHKLSSTQSKYSPYDRELLSVYEAIKHFRHMIEARNFTIFTDHKPLTFAFSVNREKCSPRQFRYLDYISQFTTDIKYIPGKDNVVADALSRVDEVAPCIDYERLARSQEQDPELQDLLRNGSSLKLESYLLSIVAYPFIATPVCTLHDHSSQKICEDKSSTHCMDFITQDRQLQSDWYCLTVIDRFTRWPEAIPLSEITAEACAAALVTGWIARFGCPLRVTTDRGRQFESHLFKAIAALIGAHHFRTTAYHPAANGIVERMHRQLKAAIMCHTSSQWTEALPLVLMGMRSSWKDDIDASPAELVYGEPLCLPGQFISPNEDYKVSDVTQYATRLRACMANLTPRPTSWHSNSPFYIPRDLHTTSHVFIRQDHVRGSLVPPYAGPFKVVKRQPKFFTVEVRGKLVNVSIDRLKPAYMTRVPEGVSPTKPVEKTTRSGRKIKLPDYYRP

Summary

Catalytic Activity
alpha-D-galactose 1-phosphate + UDP-alpha-D-glucose = alpha-D-glucose 1-phosphate + UDP-alpha-D-galactose
Similarity
Belongs to the galactose-1-phosphate uridylyltransferase type 1 family.
EC Number
2.7.7.12
EMBL
AAGJ04001742    GBXI01017046    JAC97245.1    LBMM01008151    KMQ89105.1    GEGO01003506    + More
JAR91898.1    LBMM01012030    KMQ86466.1    JYDR01000002    KRY79251.1    GEZM01017686    JAV90495.1    JYDT01000067    KRY86703.1    ABLF02011086    ABLF02042879    ABLF02030693    ABLF02030697    KL363205    KFD54770.1    MRZV01002078    PIK34788.1    LBMM01001181    KMQ96765.1    KL367555    KFD64489.1    AAZX01004093    AAZX01004778    AAGJ04112098    MRZV01000197    PIK55880.1    LBMM01012567    KMQ86146.1    AAZX01005104    JYDV01000289    KRZ22781.1    JYDR01000355    KRY64563.1    JYDM01000100    KRZ87482.1    KL367590    KFD62660.1    KRZ87481.1    AAZX01024401    KL363200    KFD55431.1    KQ971355    EFA07205.2    KL367564    KFD63933.1    JWZT01001363    KII72172.1    KL367778    KFD59660.1    KL367543    KFD65158.1    KL367558    KFD64270.1    KL367544    KFD65142.1    KL363373    KFD46409.1    JYDU01000460    KRX86127.1    MRZV01000001    PIK63042.1    JYDJ01000353    KRX36608.1    AAGJ04130731    ABLF02057446    ABLF02059301    CAAE01013786    CAF95469.1    ABLF02006595    ABLF02011068    ABLF02055413    JYDV01000002    KRZ45603.1    JYDK01000186    KRX73103.1    JYDK01000369    KRX69330.1    JYDK01000100    KRX76473.1    ABLF02058233    KL367644    KFD60876.1    KFD55401.1    ABLF02040931    ABLF02040938   
Pfam
PF17917   RT_RNaseH        + More
PF00078   RVT_1
PF00665   rve
PF17921   Integrase_H2C2
PF17919   RT_RNaseH_2
PF01087   GalP_UDP_transf
PF00077   RVP
Interpro
IPR001584   Integrase_cat-core        + More
IPR012337   RNaseH-like_sf       
IPR000477   RT_dom       
IPR041373   RT_RNaseH       
IPR036397   RNaseH_sf       
IPR041588   Integrase_H2C2       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001995   Peptidase_A2_cat       
IPR041577   RT_RNaseH_2       
IPR001969   Aspartic_peptidase_AS       
IPR034132   RP_Saci-like       
IPR005849   GalP_Utransf_N       
IPR019779   GalP_UDPtransf1_His-AS       
IPR001937   GalP_UDPtransf1       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR036265   HIT-like_sf       
IPR018061   Retropepsins       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF54197   SSF54197       
SSF56219   SSF56219       
PDB
4OL8     E-value=2.51455e-65,     Score=636

Ontologies

Topology

Length:
1153
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.03928
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00055
outside
1  -  1153
 
 

Population Genetic Test Statistics

Pi
158.803767
Theta
154.427968
Tajima's D
0.888117
CLR
0.000172
CSRT
0.629968501574921
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号