SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03580
Annotation
PREDICTED:_uncharacterized_protein_LOC106116522_[Papilio_xuthus]
Location in the cell
PlasmaMembrane   Reliability : 2.225
 

Sequence

CDS
ATGGCCTCAGCTTCTTTTATAGCAACCCGATGTCTTATACAGCTAGGCAATGAAGCTCACGATGACGATGTTAAGCGCGCTATATGTCATGACTTTTATGTTGATGACTACTTAGGTGGAAGTCACACCATTCACAGCACCATAGAATTGTGCAGAAAGATTAAAGTTGCCCTCCAGTCTGGACAATTTAATCTTCGTAAATGGCATTCCAATAGTTCTGAAATTCTCAGAGCTGTTAGCGATACTTCGAATGATAACGCAGATTGTGTAGATCTGAGTTCCAACGAACACTCGAAGACTTTAGGTCTTAATTGGAAATGTCGCGCTGACAATTTATACTTTTCGATAAATTTGTCACCTTCACTCATTATAACAAAGCGGTATATCTTGGCTACCGTAGCCCAAATATTTGACCCGCTTGGCTTAGTTTCGCCTTGCATTGTAGAAGCTAAGCTTTTGCTGCAAGATCTCTGGAAACATAAATGCTCATGGGACGACGAGATCATGGAACCTTTAAAGAAGACATGGCTTAACTTTGTTAAAACCTTACCTCATCTCAATGATATTCTAATTCCACGCTGCGTTATTTCTCAGCCGATTGGAATACAGCTTCATGTTTTCACGGACGCATCGGAGAGAGCCTACGGCGCATGTGTTTATGTTCGAAGTGAGACGTCAGAAGGATCCATAAAAACCATTCTTTTAGCATCAAAAAGCAAAGTAGCTCCTATAAAAACTACTACGATTCCAAGACTGGAACTTTGTGCCGCCATGCTTGGTTCCAAATTATGTGAAAAGATCACCACGACTTTAACATTAAAAGTAGAAAGGTGTTCATTTTGGTCGGACTCAACGATAGTTCTCGGTTGGATTGCCTCTTCTGCAATTCATTTGAAAAAATTCGTAGCTCATCGTGTGTCTGAGATACAGAAAATCTGCGCTGGACACGAATGGCGATTTAAGGCTACTACTGTTCAGCCACCCATGGGGGATTTACCACGTCAACGTGTGCACCTGGAATATCCCTTTCTTCAAACTGGCGTTGATTACGCTGGCCCAGTGTTGGTAGCAAACCGGAAAGGTAGAGGTTCTAAACTAATAAAATCATACATCTGCGTGTTCGTATGTTTGGCAACGAAGGCCGTACATTTGGAGCTTGTCTCAGACCTGTCCAAGGATGCATTCATTGCTGCTTTGAATAGATTTACTGCGCGACGCGGGAAGCCACAATCAATTCTGTCTGATAATGGTACCACCTTTGTTGGAACGTTCAATGAATTATCCAAACTTCTTAGTCGTACCCTTCCTTCCGATTTGGCAGAGCAAGAGATTAAATTTTCTTTTATACCGGCATACACACCACATTTTGGCGGACTTTGGGAGTCAGCCGTTAGGTCTACGAAATATCACTTGCGTAGAATTTTAGGGCTAACACATCTCACATTTGAAGAAATGACGACTTTATTAACTCAAATTGAAGCCATTTTAAATTCAAGGCCTCTCATTCCTCTGTCAGATGATCCTTCGGACTATTATCCTCTCACTCCAGCTCATTTCCTAATAGGACGATCTTTACTCTTTGTACCTCAGCCTGATTTAACAAATCATTCAACTTTAACCTCTCTTAAGAGATTCCAGCGTATCGAGTACCTTAAGCAGCATTTTTGGCAGCGATTCTCCAATGAGTACGTCGTGTGGCTACAACAAAAAATGAAATGGCCGACTCAAAAGGGAGACTTAAAAGAAGGTATGATGGTTGTCATCAAGGAGAAGGGACTACCACCTCTTATGTGGCTGCTCGGACGCATTATTCGTCTTTGTCCTGGACGAGATGGAATTACACGTGTGGCAGATATCTTAACCAAGAAAGGTGTTATACGACGCGCTTACAACAACATATGCCCGCTACCAGTCAATATTTGA
Protein
MASASFIATRCLIQLGNEAHDDDVKRAICHDFYVDDYLGGSHTIHSTIELCRKIKVALQSGQFNLRKWHSNSSEILRAVSDTSNDNADCVDLSSNEHSKTLGLNWKCRADNLYFSINLSPSLIITKRYILATVAQIFDPLGLVSPCIVEAKLLLQDLWKHKCSWDDEIMEPLKKTWLNFVKTLPHLNDILIPRCVISQPIGIQLHVFTDASERAYGACVYVRSETSEGSIKTILLASKSKVAPIKTTTIPRLELCAAMLGSKLCEKITTTLTLKVERCSFWSDSTIVLGWIASSAIHLKKFVAHRVSEIQKICAGHEWRFKATTVQPPMGDLPRQRVHLEYPFLQTGVDYAGPVLVANRKGRGSKLIKSYICVFVCLATKAVHLELVSDLSKDAFIAALNRFTARRGKPQSILSDNGTTFVGTFNELSKLLSRTLPSDLAEQEIKFSFIPAYTPHFGGLWESAVRSTKYHLRRILGLTHLTFEEMTTLLTQIEAILNSRPLIPLSDDPSDYYPLTPAHFLIGRSLLFVPQPDLTNHSTLTSLKRFQRIEYLKQHFWQRFSNEYVVWLQQKMKWPTQKGDLKEGMMVVIKEKGLPPLMWLLGRIIRLCPGRDGITRVADILTKKGVIRRAYNNICPLPVNI

Summary

Pfam
PF00665   rve        + More
PF05380   Peptidase_A17
PF18701   DUF5641
PF03564   DUF1759
PF05585   DUF1758
PF05699   Dimer_Tnp_hAT
Interpro
IPR040676   DUF5641        + More
IPR008737   Peptidase_asp_put       
IPR021109   Peptidase_aspartic_dom_sf       
IPR036397   RNaseH_sf       
IPR005312   DUF1759       
IPR001584   Integrase_cat-core       
IPR008042   Retrotrans_Pao       
IPR012337   RNaseH-like_sf       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR008906   HATC_C_dom       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
640
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.177530000000001
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00803
outside
1  -  640
 
 

Population Genetic Test Statistics

Pi
454.388529
Theta
193.61926
Tajima's D
4.104814
CLR
0.298304
CSRT
0.9990000499975
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号