SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03570
Annotation
reverse_transcriptase_[Lasius_niger]
Full name
Probable RNA-directed DNA polymerase from transposon X-element       + More
Probable RNA-directed DNA polymerase from transposon BS      
Alternative Name
Reverse transcriptase
Location in the cell
Mitochondrial   Reliability : 1.757 Nuclear   Reliability : 1.984
 

Sequence

CDS
ATGAAGTCAGCGTCGGAACGATACTTCGATAAGGCTATGCGTCATGATAATCGCCTTATCGTTGCCGCCGCTGACTACTCCCCGAATCCTGATCATGCAGGAGCCAGTCACCGTCGACGCCCTAGACACGTCCTTACGGATCCATCAGATCCAATAACCTTTGCATTAGATGCCTTCATCTCTAATACTAGGGGCAGGCTTAGGGACCCCGGCTTTTCCGTGTACGTCACCTGTCATCCTGATGGAGGGGCCCACGCTGGCACCGCGATAATTATCAAGAACGGTATAAAGCATTATCTCCTGGAATCTACTGCGGCTCCCTATCTCCAATCCACAACTGTAAGGGTGGAGGATCGTTCCGGACCCCTAATCCTTTCTGCGATATATTGTCCACCGCGCCACACAATAAAAGAAAAAATGTTTACTGAGTTTTTTATGTCTTTAGGCAACCGATTCATTGCTGGTGGCGATTGGAATGCCAAGCATACATACTGGGGCTCAAGATTAACAGTAACTAGAGGTCGGGAATTGAAAAAGAGCATTGAAACTAATCACTTGTTAGCTATGACAACTGGAGAGCCCACATATTGGCCTACGGACAGTAACAAAATACCAGACCTCCTAGATTTCTTTATTACTAAGGGTATCAGCGCACAAAATACTCTGATAAAGGCAAGTCTCGACGGCAGCTCTGACCATTCACCTGTCTTGCTTACGCTTAGCTCAATGGCTATGCCCAGCGATACCCATACCGTCTATCTCCACAATTATAGAACTGATTGGCAATGTTTTCGGGAATTCCTCGAATCAAACATAAACCTATGTATTCCACTCAAAACCAAAGATGACGTTGACGACGCATGCCTCTATATTACAAACTTTATTCAAGTGGCAGCTTGGTCTAGTACACCCGAGCTGAAGGGTCTATCGAGAGGGGCTCCAATCCCTCTTGCTATCAAGGAAAAAATCGCCGCCAAACGTCGCCTTCGCAAAATTTGGCAGACAACCCACCGATGTGCGGATAAAACCAGACTAAATCGAGCTATTAAAGAACTCAAAGATCTTCTGGATTACGCTTCAAACGAATCACTCACGCAGAGATTGGAAAAAATGTCTCCAAATGCAAATGGCTCTCACAACCTCTGGAAGGCAACAAAGTACCTCCCACAGCCGCAGCAGTGCTCTCCGCCTTTAAGATCCGGTAATAAATGGGCGCGAACTGACCAGGAAAAATCTCAGGCCTTCGCTATATACCTGGCTGAAGTATTTAAACCCAACAGTACGGATAGTCCAGAGGATCCCGAAATAAACCGAGTATTAAAGCAAGACTTGCAATTATGCCTACCCTTGAGTCCTACAACACCAAAAGAGATAGCTAGAGAAATAGCCAAAATGGACCATAATAAAGCGCCTGGATTTGACTTGGTTACTCCCAGACTATTGAAAGAGCTCCCTAGGAGGTGCATTCTCTTTTTGACCATTCTTGTCAATGCCACATTGAGAATGTCGTATTTCCCTGCACTCTGGAAAACATCCCAAATTGTGATGATCCAAAAACCTGGGAAACCGCCTAACGAGGTGTCTTCTTATCGCCCTATTAGCCTGACGCCGGTTTTGTCAAAGTTATGGGAAAGGATCTTCTTGGCACGATTATCCCCTTGCCTGGATGCATGCCATATAATACCTGACCACCAATTTGGCTTCCGGAAGCACCACTCAACCATAGAACAGGTACACAGAGTGTATTGTACAATAAGACATTGTCTGGAGAGGAAAGAGTACTGTTCTGCTGCTTTTCTCGACGTACAACAAGCTTTTGATCGAGTTTGGCATAGGGGACTGCTCTGTAAAATTAAAAAGTACCTTCCACATTCCTACTTTCTGCTGTTAGAGTCTTATCTCAGTGACAGAAGGTTTCAAGTCAAGCTCCGTGATGCCAGATCTTCTGTCTTTGCCTGCAGAGCCGGAGTGCCCCAAGGCTCCGTACTTGGTCCGGTCCTCTACAACATTTTTACTAGCGATTTACCCCAGTCACCAGAAATAGCTGTAGCAACCTTTGCCGATGATGCAGCCTTCCTCAGTTGTAGCAGTGATCCTAATGAAGCGACTAGACTGTTGCAAACCCAGCTCGATGTCACTAACACTTGGATGACCAAGTGGCGCATTAAAGCTAGCGCCCCCAAGTCTCACCACATCACATTTACCCTAAGACGTGATACTTATCCTCCAGTCAAACTCGGCCACGATACATTGCCGCAATCAACCTGTGTTAAGTATCTTGGATTCCACTTGGACCGAAGGATGACATGGAAAGACCACATAAAAACGAAACGTAACGAAATTAACATTAGATTTAAAAACCTACTCTGGCTTCTCGGTAGACAGGCTGCCTTATCCCTATCCAACAAGCTACGGGTGTATTGTTCAATAATAAAACCGATCTGGACGTATGGAATCCAACTGTGGTCGACAGCCAGCAAATCCAACATTATGTGCCTCCAGAGAGCTCAAAACAGTATCCTGAGGGTACTCTCGTCGGCGCCTTGGTATACTCGAAATTCGGAAATCCACGAGTACCTGGAAATCCCAACCATCTTGGATGAAGTTAAACGATACTCAGCCAACTATAAGAACCGCTTGAAAGCTCACCCAAACCCGTTGTCCGGCTTACTATTGCAGCCAAATCCGATTAAAAGACTCAAGAGAGCCGACGTGCTACCCTACTAA
Protein
MKSASERYFDKAMRHDNRLIVAAADYSPNPDHAGASHRRRPRHVLTDPSDPITFALDAFISNTRGRLRDPGFSVYVTCHPDGGAHAGTAIIIKNGIKHYLLESTAAPYLQSTTVRVEDRSGPLILSAIYCPPRHTIKEKMFTEFFMSLGNRFIAGGDWNAKHTYWGSRLTVTRGRELKKSIETNHLLAMTTGEPTYWPTDSNKIPDLLDFFITKGISAQNTLIKASLDGSSDHSPVLLTLSSMAMPSDTHTVYLHNYRTDWQCFREFLESNINLCIPLKTKDDVDDACLYITNFIQVAAWSSTPELKGLSRGAPIPLAIKEKIAAKRRLRKIWQTTHRCADKTRLNRAIKELKDLLDYASNESLTQRLEKMSPNANGSHNLWKATKYLPQPQQCSPPLRSGNKWARTDQEKSQAFAIYLAEVFKPNSTDSPEDPEINRVLKQDLQLCLPLSPTTPKEIAREIAKMDHNKAPGFDLVTPRLLKELPRRCILFLTILVNATLRMSYFPALWKTSQIVMIQKPGKPPNEVSSYRPISLTPVLSKLWERIFLARLSPCLDACHIIPDHQFGFRKHHSTIEQVHRVYCTIRHCLERKEYCSAAFLDVQQAFDRVWHRGLLCKIKKYLPHSYFLLLESYLSDRRFQVKLRDARSSVFACRAGVPQGSVLGPVLYNIFTSDLPQSPEIAVATFADDAAFLSCSSDPNEATRLLQTQLDVTNTWMTKWRIKASAPKSHHITFTLRRDTYPPVKLGHDTLPQSTCVKYLGFHLDRRMTWKDHIKTKRNEINIRFKNLLWLLGRQAALSLSNKLRVYCSIIKPIWTYGIQLWSTASKSNIMCLQRAQNSILRVLSSAPWYTRNSEIHEYLEIPTILDEVKRYSANYKNRLKAHPNPLSGLLLQPNPIKRLKRADVLPY

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
At least 30 copies of X-element are present in the genome and some elements are polymorphic between different strains.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  Probable RNA-directed DNA polymerase from transposon X-element
EC Number
2.7.7.49
EMBL
NWSH01000032    PCG80496.1    NEVH01006736    PNF36716.1    NEVH01007402    PNF35856.1    + More
NEVH01016340    PNF25410.1    NEVH01021925    PNF19341.1    NEVH01015305    PNF27092.1    NWSH01007753    PCG62823.1    NEVH01001347    PNF42959.1    NEVH01008277    PNF34262.1    NEVH01023979    PNF17579.1    NEVH01016302    PNF25823.1    NEVH01020940    PNF20481.1    NEVH01026386    PNF14434.1    LBMM01013518    KMQ85605.1    NEVH01005295    PNF38784.1    NEVH01019963    PNF22185.1    GEZM01053022    JAV74219.1    GEZM01084969    JAV60363.1    ABLF02041861    KU543673    AMS38352.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    GFTR01008261    JAW08165.1    GAKP01017773    JAC41179.1    GEDC01000337    JAS36961.1    KU543687    AMS38379.1    GGMR01000226    MBY12845.1    CP012527    ALC48130.1    X17551    CAA35587.1    AY508487    AAS13459.1    LBMM01012041    KMQ86458.1    GFTR01008169    JAW08257.1    KU543685    AMS38375.1    GFTR01008256    JAW08170.1    GFTR01008251    JAW08175.1    GFTR01008257    JAW08169.1    AY047531    AAK77263.1    GGMR01000676    MBY13295.1    GGMR01016905    MBY29524.1    DNOY01000259    HBE18313.1    M17214    AAA28508.1    GFTR01008246    JAW08180.1    GGMR01003864    MBY16483.1    GGMR01006491    MBY19110.1    GFTR01008269    JAW08157.1    GFXV01000908    MBW12713.1    GBHO01008295    JAG35309.1    GGMR01003407    MBY16026.1    NEVH01006721    PNF37225.1    GFTR01008254    JAW08172.1    GGMR01016296    MBY28915.1    GBGD01000389    JAC88500.1    GECL01003538    JAP02586.1    LBMM01005178    KMQ91747.1    GFTR01008151    JAW08275.1    ABLF02016613    GGMR01012305    MBY24924.1    GGMS01006655    MBY75858.1    LBMM01012078    KMQ86419.1    LBMM01006314    KMQ90710.1    GGMR01012443    MBY25062.1    GFXV01002840    MBW14645.1    GBBI01003810    JAC14902.1    NEVH01020963    PNF20308.1    GFTR01008271    JAW08155.1    GGMR01006408    MBY19027.1    GGMR01011511    MBY24130.1    GBBI01003747    JAC14965.1    ABLF02014118    ABLF02014121    ABLF02054790    GGMR01005022    MBY17641.1    GGMR01012283    MBY24902.1    GFTR01008260    JAW08166.1    GEZM01021881    JAV88842.1    GGMR01012676    MBY25295.1    GGMR01020516    MBY33135.1    GFTR01007997    JAW08429.1    GDHC01020244    JAP98384.1    GGMS01006359    MBY75562.1    LBMM01015125    KMQ84919.1    GGMR01013409    MBY26028.1    GGMS01017365    MBY86568.1    GFDF01007661    JAV06423.1    ABLF02021819    ABLF02021820    ABLF02055326    ABLF02017755    ABLF02044739    ABLF02063495    ABLF02065698    ABLF02066197    AF237761    AAF81411.1    ABLF02024784    ABLF02024792    ABLF02034460    GFTR01007929    JAW08497.1    GDHC01018248    JAQ00381.1    ABLF02025048    ABLF02063033    GGMR01000857    MBY13476.1    ABLF02040174    ABLF02040183    ABLF02055266    GGMR01014053    MBY26672.1    GGMS01002786    MBY71989.1    GGMS01000737    MBY69940.1    AY060438    AAL25477.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
6AR3     E-value=0.000377866,     Score=107

Ontologies

Topology

Length:
908
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.14615
Exp number, first 60 AAs:
0.00032
Total prob of N-in:
0.00382
outside
1  -  908
 
 

Population Genetic Test Statistics

Pi
399.936912
Theta
236.776225
Tajima's D
2.74387
CLR
0.516937
CSRT
0.965001749912504
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号