SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03564
Pre Gene Modal
BGIBMGA002389
Annotation
PREDICTED:_mucin-2-like_[Amyelois_transitella]
Location in the cell
Nuclear   Reliability : 2.495
 

Sequence

CDS
ATGGCTGGAAGTTACATTGTCAACGTGCCTAAATTGAAAGGTCGCGAAAACTTCGACGAGTGGGCGTTTGCAGCTGAACATTTTTTGATGTTGGAAGGTGTCGATATTCATAAGTTAGAATCATCAACCGATGCTAGTTCTATTGATGAAAGAAAAGCTAAAGCTAAACTTATTATGACAATTGACTCTTCAATTTATGTTCACATTAAAAACGAGCAAACAGTACAAGGTGTGTGGAAGCGTTTAAAAGCCCTGTACGATGACTGTGGCTTTACGCGTCGCATCAGTCTACTTCGTCAGCTAATATCAATTCGATTAGAAGATAGCGAATCAATGGAAGCATATGTAACGCAAATGGTCGACACTGCACAAAAACTTAAAGGTACGGGTTTTCAGATCACTGATGAGTGGATCGGTTCACTATTATTAGCGGGCCTAACAGATACATTTGCTCCTATGATAATGGCCATTGAACATTCTGGATTAGCCATCAGTACGGATGCCATCAAGTCAAAATTACTGGACATGAGTTCAGAAGTTGGCAACACTGCAACTAACAATGCCTTTTTGTCGAAAGTAAGTCAGATGATTCGTAATGGAAACAAAGTGAGCTTCGAAGAAGACGTTTGTTACATACGCAATCGACAGAATGTGCTGGTAGGAAAAGCAAACCTGGTGAATGGAGTCTATAAATTGGACATTAAGTCAGACAGTTTGTTCGCGTGCTCAGCCACAACTGTGACTAGTGAGATATGGCATCGAAGATTAGGACACATTAACAGTAGAAGCTTGAATATTATGAAGAATGGTGCTGTGGATGGGATATCATACATGGATAAAGCTGAAATTGATATGTCCAAGTGCATCATATGCTGTGAAGGAAAACAGTCAAGGTTGCCATTTTCACATAAAGGTACGAGAAGTGAAAATGTGCTTGAACTTGTTCATGCAGATGTCTGTGGACCCATGGAACAACCTTCTATTGGACTATCAAAGTATTTTTTGCTTTTTGTAGATGACTACAGTAGAATGGCATTTGTGTTTTTTCTCAAAGCCAAGAACCAAGTTTTCAAATATTTTAAAGAGTTCAAAACTCTGGTTGAGACACAGACAGGCAGAAAACTAAAAGCCTTAAGGACAGATAATGGTGGAGAGTTTTGTTCGCTAGAATTTGATGAGTTTTTGAAGAAAAATGGCATAGTACATCAAACAACAAACCCTCATACACCAGAACAGAATGGCCTGTGTGAAAGACTTAATAGAACTGTCGTGGAGAGAGCTCGGTGTCTTCTGTTTGAAGCAGGCCTAGATAAAAAGTTTTGGGCCGAAGCAATCAACACAGCAGTCTATTTACGAAATAGAACATTGGCAGCAGGACTTCAGAAAACACCTTATGAAATATGGAGTGGTAAAAAGCCAAATCTAAGTCATATACGGATATTTGGTAGTCCTGCAATGGTCCATGTCCCCAAAGCAAAGCGGACTAAATGGAACAAGAAGGCCAATGAACACATCCTGATTGGATACTCAGAGAGTACCAAAGGATACAGGCTGTACAATGTAAAAACAAAAAATATTACCACTAGCAGGGATGTTGTTATCATGGAGAAAATCAACGACACAGATATGATACAAGCAGTAGTGGAAGAAAAAGAAACTATTCCAAGTGAAGAAGGAATACAAAAATGTGCTGTGACAAGTGAAGATTCCACTTGTGACTCACTAAATAGCACATACATGACAGATGATGCTACATATGTACCAGATGATACCAGTACCACCAGCTCAGATGAATTCTGTGATAGTAAATCGAATCACAAGTCAGAAAATCTGCAGCCAATAATTAAGGTGGAAAAGAGGACTAGGAAGAAACCAGACTGGTATGGGTACAATAACATATGTCAGAGCAGTGAGGAGGTGGACGACAATCTTCTCACTTATGAGGATGTAATGAGAGGATCAGAACAAGAAGAATGGTCAAAAGCCATGAAAGAGGAAATACAATCTTTCCATCAGAATGATGCTTGGGAGTTAGTAGACAGACCCAGTGGTGAAAATATTGTGGCATGCAAATGGGTGTATAAAAAGAAACTTAACAGTGACAACTCAGTGAGATATAGGGCACGGTTGGTTGCGAAGGGTTTCAGCCAGAGACAGGGTATAGACTTTAAAGAAACTTTTTCCCCAGTGCTAAAATATTCCACTTTAAAACTGTTATTTGCTATTAGTGTTAACTTGAATCTTAGCATAACCCATTTGGATGTAACGACGGCCTTTTTGAATGGTCACCTAGATGAAACTGTTTTTATGCAATTGCCTCAGAGTTTTGAATGTAAACCTAATGCTGATAAAGTCTTGAAATTGAAAAAGGCCATTTATGGACTAAAACAGTCAGCGAGGGCCTGGCGAATTTCGACTACCGGGGGACCACTAGCCCTTCTACAGGCGCATGATGTGGTCGCCAGAGAAGTGTACGGTGAGGAGTCATTGCGTGCCTCTCCGCCGCCGGTCAACGGTCGCACGACGGCACCGCCGCCCGAAGAGGAAGACGACGCCGAACCCGAATTCGAGAACGTGACCAGGGTGCGCCTCGTGCAGTTCCAGAAAAACACCGACGAGCCAATGGGAATTACTCTGAAACTAGCGGACGACGGACGTTGCATCGTTGCTCGTATTATGCACGGCGGTATGATACATCGCCAGGCGACGCTGCATGTCGGTGACGAGATTAAAGAGATTAACGGAACGCCTGTCGCAAATCAATCTGTCGCTCAACTACAAAGAATGCTGCGCGAGGCTCGCGGCTCCGTCACTTTCAAGATCGTACCTTCCTACCGCTCGGCACCACCACCCTGCGAGCTTTTCCGGATAAAGCCTTCGCCCGTGCTAATATTCGTTCGAGCGCAGTTTGATTACGATCCCTTGGAAGACGAACTAATCCCGTGTGCTCAAGCAGGCATCGCCTTCAACACCGGCGACATATTGCAGGTTAGTTGTGTATTATGGGTATAA
Protein
MAGSYIVNVPKLKGRENFDEWAFAAEHFLMLEGVDIHKLESSTDASSIDERKAKAKLIMTIDSSIYVHIKNEQTVQGVWKRLKALYDDCGFTRRISLLRQLISIRLEDSESMEAYVTQMVDTAQKLKGTGFQITDEWIGSLLLAGLTDTFAPMIMAIEHSGLAISTDAIKSKLLDMSSEVGNTATNNAFLSKVSQMIRNGNKVSFEEDVCYIRNRQNVLVGKANLVNGVYKLDIKSDSLFACSATTVTSEIWHRRLGHINSRSLNIMKNGAVDGISYMDKAEIDMSKCIICCEGKQSRLPFSHKGTRSENVLELVHADVCGPMEQPSIGLSKYFLLFVDDYSRMAFVFFLKAKNQVFKYFKEFKTLVETQTGRKLKALRTDNGGEFCSLEFDEFLKKNGIVHQTTNPHTPEQNGLCERLNRTVVERARCLLFEAGLDKKFWAEAINTAVYLRNRTLAAGLQKTPYEIWSGKKPNLSHIRIFGSPAMVHVPKAKRTKWNKKANEHILIGYSESTKGYRLYNVKTKNITTSRDVVIMEKINDTDMIQAVVEEKETIPSEEGIQKCAVTSEDSTCDSLNSTYMTDDATYVPDDTSTTSSDEFCDSKSNHKSENLQPIIKVEKRTRKKPDWYGYNNICQSSEEVDDNLLTYEDVMRGSEQEEWSKAMKEEIQSFHQNDAWELVDRPSGENIVACKWVYKKKLNSDNSVRYRARLVAKGFSQRQGIDFKETFSPVLKYSTLKLLFAISVNLNLSITHLDVTTAFLNGHLDETVFMQLPQSFECKPNADKVLKLKKAIYGLKQSARAWRISTTGGPLALLQAHDVVAREVYGEESLRASPPPVNGRTTAPPPEEEDDAEPEFENVTRVRLVQFQKNTDEPMGITLKLADDGRCIVARIMHGGMIHRQATLHVGDEIKEINGTPVANQSVAQLQRMLREARGSVTFKIVPSYRSAPPPCELFRIKPSPVLIFVRAQFDYDPLEDELIPCAQAGIAFNTGDILQVSCVLWV

Summary

Pfam
PF00665   rve        + More
PF13961   DUF4219
PF07727   RVT_2
PF13976   gag_pre-integrs
Interpro
IPR001584   Integrase_cat-core        + More
IPR039537   Retrotran_Ty1/copia-like       
IPR013103   RVT_2       
IPR012337   RNaseH-like_sf       
IPR025314   DUF4219       
IPR025724   GAG-pre-integrase_dom       
IPR036397   RNaseH_sf       
SUPFAM
SSF53098   SSF53098       
Gene 3D
ProteinModelPortal
PDB
1KWA     E-value=4.4075e-36,     Score=383

Ontologies

Topology

Length:
1003
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.13334
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00599
outside
1  -  1003
 
 

Population Genetic Test Statistics

Pi
230.645231
Theta
165.69263
Tajima's D
0.830504
CLR
0.525304
CSRT
0.608269586520674
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号