SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03556
Pre Gene Modal
BGIBMGA010007
Annotation
putative_DNA_helicase_[Cotesia_vestalis_bracovirus]
Full name
ATP-dependent DNA helicase      
Location in the cell
Mitochondrial   Reliability : 1.233 PlasmaMembrane   Reliability : 1.258
 

Sequence

CDS
ATGCCACGTTATTATACTTGGAATGCTTCATCGAAGAATTTTCAAAGACGGAAGCAAGGCGATGCGGTTCCTGGGTATCCAGATGTGCGTTCTACTGATGCTCTTGGTCGTATGTATACAGTTCATCCAAAGAATAATGAATGTTTCTATTTGCGGTTGTTGCTGGTAAATGTGCGTGGGCCAACGTCATTTGAGTCACTACGAACTGTTAATGGTGTAATATTCCCAACATATCGTGCTGCATGTGAAGAATTGAAGTTATTAGAAAACGATAGTCATTGGGATACGACAATCGCTGAAGCCATTATCTCTGCATCTCCAAGTCAGATACGCACATTATTCGCTATCATAATTTCGACATGTTTTCCATCAAACCCATGTAACCTGTGGCACAAATACAAGGATAATATGTCAGAAGATATTTTACATCAAATTCGTGTCAGTTCCAGAAATCACGATATTGAGATGAATGAGGAGATACATAATCGTGCTTTACTCTTGATCGAAGATATGTGTTACCTCATGTGCGGTAATTTATTAATCAGGTTAGGAATGCCAGCACCATATCGTGAAATGAATGACGCATTTAATCGAGAATTGGAAAGGGAACGTGAATATGATCACCAGGAATTAGATTTAGTAGTTCAAACGAATGTACCCCTGTTGAATTACCAACAAAAGGAAGTTTATGATACTTTAATGAAGGCAATCGATGATGAAAATGGTGGTTTATATTTCCTAGATGCCCCTGGTGGAACTGGCAAGACATTCCTCATGTCATTAGTTTTAGCAACTGTTCGGGCGAGATTTAACATAGCGGTTGCAGTTGCTTCTTCTGGAATAGCAGCCACATTGTTAGAAGGATGCCGTACGGCTCATTCAGCTTTCAAATTACCGTTAAATCTTCAAACTATTGAAGAACCAACGTGTAATATTGCAAAACACTCAGCAATGGCCAAAGTTTTAGCGGTATCGAAAATCATCATCTGGGACGAATGCACAATGGCGCATAAACGTACTTAA
Protein
MPRYYTWNASSKNFQRRKQGDAVPGYPDVRSTDALGRMYTVHPKNNECFYLRLLLVNVRGPTSFESLRTVNGVIFPTYRAACEELKLLENDSHWDTTIAEAIISASPSQIRTLFAIIISTCFPSNPCNLWHKYKDNMSEDILHQIRVSSRNHDIEMNEEIHNRALLLIEDMCYLMCGNLLIRLGMPAPYREMNDAFNRELEREREYDHQELDLVVQTNVPLLNYQQKEVYDTLMKAIDDENGGLYFLDAPGGTGKTFLMSLVLATVRARFNIAVAVASSGIAATLLEGCRTAHSAFKLPLNLQTIEEPTCNIAKHSAMAKVLAVSKIIIWDECTMAHKRT

Summary

Catalytic Activity
ATP + H2O = ADP + H(+) + phosphate
Cofactor
Mg(2+)
Similarity
Belongs to the helicase family.
EC Number
3.6.4.12
EMBL
LC056060    BAW33744.1    GAIX01013838    JAA78722.1    HQ009558    AEE09607.1    + More
BABH01039432    GL444143    EFN61253.1    RSAL01000340    RVE42412.1    HACG01048804    CEK95669.1    HACG01048799    CEK95664.1    RSAL01000338    RVE42429.1    HACG01048801    CEK95666.1    ABLF02039404    HACG01048798    CEK95663.1    ABLF02017703    ABLF02041883    ABLF02039418    ABLF02041882    ABLF02015085    ABLF02015086    GBXI01016780    JAC97511.1    KN778727    KIH44308.1    ABLF02016067    ABLF02055484    KN739098    KIH54434.1    ABLF02016932    KN747262    KIH51216.1    KE126587    EPB66060.1    JARK01000714    EYC35207.1    ABLF02042290    KN726708    KIH67418.1    KN739487    KIH54222.1    KN743176    KIH52626.1    JOJR01000723    RCN34924.1    JOJR01001507    RCN30639.1    JOJR01000111    RCN45090.1    KN730521    KIH60924.1    JARK01001590    EYB87952.1    HACG01048803    CEK95668.1    RSAL01001639    RVE40746.1    HACG01048800    CEK95665.1    KK118751    KFM73771.1    KE125929    EPB66767.1    KE125664    EPB67478.1    NIVC01000229    PAA87485.1    NIVC01000366    PAA84583.1    NIVC01001359    PAA68995.1    NIVC01000111    PAA90396.1    NIVC01001445    PAA67902.1    GECZ01020386    JAS49383.1    JOJR01000020    RCN50729.1    NIVC01001486    PAA67379.1    UYRW01006776    VDM94602.1    ABLF02041819    ABLF02020814    ABLF02049665    ABLF02012908    ABLF02042833    KN726282    KIH68828.1    ABLF02024220    ABLF02041348    ABLF02018127    NIVC01004230    PAA48122.1    NIVC01002034    PAA61410.1    NIVC01001383    PAA68602.1    NIVC01000900    PAA75136.1    NIVC01001115    PAA72069.1    NIVC01000566    PAA80832.1    UYRW01009134    VDM97499.1    PAA80831.1    NIVC01001660    PAA65355.1    NIVC01001478    PAA67511.1    NIVC01000419    PAA83453.1    NIVC01000175    PAA88803.1    NIVC01001722    PAA64736.1    NIVC01001945    PAA62370.1    NIVC01000381    PAA84309.1    NIVC01000291    PAA86185.1    NIVC01004666    PAA46875.1    NIVC01004811    PAA46541.1    GGMS01015273    MBY84476.1    GGMS01010390    MBY79593.1    KQ418414    KOF87426.1    NIVC01003989    PAA49045.1    BDIQ01000091    GBC29771.1    NIVC01001160    PAA71495.1    JEMT01022708    EXX64911.1    NIVC01002018    NIVC01001743    NIVC01000051    PAA61561.1    PAA64516.1    PAA92464.1    BDIQ01000188    GBC50999.1    NIVC01000042    PAA92669.1    NIVC01000040    PAA92731.1   
Pfam
PF05970   PIF1        + More
PF14214   Helitron_like_N
PF02689   Herpes_Helicase
Interpro
IPR010285   DNA_helicase_pif1-like        + More
IPR027417   P-loop_NTPase       
IPR025476   Helitron_helicase-like       
IPR038765   Papain-like_cys_pep_sf       
IPR003653   Peptidase_C48_C       
IPR003840   DNA_helicase       
IPR003323   OTU_dom       
SUPFAM
SSF52540   SSF52540        + More
SSF54001   SSF54001       

Ontologies

Topology

Length:
340
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
2.29289
Exp number, first 60 AAs:
0.00352
Total prob of N-in:
0.11537
outside
1  -  340
 
 

Population Genetic Test Statistics

Pi
176.761771
Theta
147.079784
Tajima's D
3.743567
CLR
0
CSRT
0.997650117494125
Interpretation
Possibly Balancing Selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号