SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03547
Annotation
PREDICTED:_uncharacterized_protein_LOC105700713_[Orussus_abietinus]
Location in the cell
Nuclear   Reliability : 1.503 PlasmaMembrane   Reliability : 1.44
 

Sequence

CDS
ATGCCTGCTACAAACTTACCTAGTAATCTTCGTGAATCTTTTAAACATCTGGTCCTCGCAGATGAGAATTTTGATAAACCATCAAATGTAGATTTACTACTCGGCGCAGAACTGTTCCATAGTATTTATGACGGTCAACGCGTTCAGCCCAGTCATGACCTACCGGTAGCTTTACACAGCGTGTTTGGTTGGGTCATCACCGGCAAACTTGATACAAACCATTTACCTCCGCCAACAATATCTTCTCTCTTAGCATCCACACGTTCTCTAGACGAGGGACTCAAGCGATTCTGGGAGATCGAAGAACCTCCAAGTCAGGTTATCTTAAACCCTGAAGATATTAAATGTGAACAAATGTACTCAAATCTAACGTATCGTAATCCCGACGGCAGATATGTTGTACCTATGCTTCTCAAAGAACCTATCAGTCAACTAGGCGATTCTTTCAACCAATCTTTCTCTCGGCTCGTTAACCTAGAACGACGCCTTAATCGAAACTTAGAGTTGAAAAAAGAGTACACCGCCTTTATGCGCGAATACAAGCTGTTAGGGCATATGGAGCCTAGCGCTGACTCGAATAAAATCGGGCAGTATATAATTCCTCATCATTGTGTCATTCGCCCGGAAAGTACAACGACTAAACTTAGGGTTGTATTCGATGCTAGCGCCAAAACTACCAATGGCAAATCTCTTAACGATCTTGTATATACTGGTCCAAAACTTCAAAACGATATAGGAGATATACTTACAAAATTTCGGTTGCATGCTGTTGTTTTTACTGCCGACATCAGTAAGATGTATCGAAACATCGAACTTAGGCCAGAAGACCGAAAATGGCAGCATATACTTTGGCGCGATTCTCCTTCTGATCCTGTAACTGAGTACGAGCTGAAAACGGTAACCTACGGGGTTACGAGTTCCCCTTATCTGGCAATACGTACTCTGCATCAATTAGCCTCTGACTACGAAAAAGAGTGGCCCTTAGCTGCTGCTAGTCTTCGTCATGATACTTTCATGGATGACATCACTGTTGGTGCTACATCTATTGAAACTGCACTGAAACATAAAGAAGAGTTAATACAAATGTTAGCGCGTGCTAAGTTCGAATTACGTAAATGGAGTAGCAACTCACCCGAATTCATCACCCAGATACCAACGGAACATTGTCAAGTTCCAAAAACATTTTGTGATGAAAAACAAAAACAAAGTATCAAGATTCTTGGAGTCCAATGGGATCCAGCTGATGATAACTTCACTTATGCTTTATCAGAACTCACTCCAGGGAATACAAAACGTGCTATTCTATCAAACGTCGCCAGAATTTATGATCCACTCGGATGGTTAGCCCCAATGGTTCTAATAGCTAAGCTTACCTTACAAGAACTATGGCGCCTTCAGCTTGACTGGGATGAAACTGTACCGTCAGATATGTTGTCTCAGTGGCATCTATTTACATCCGAGTTTCACTACCTGAAGGATATTAAAATTCCTCGACTAATTGTACCTCTTCATTCAAAATCATACGAACTTGTAGGTTTTTGTGATGGATCTACCAAGGCTTATGGTTGTTCTGTGTACTTACGTATAACTACCGACAGTGAAATTACATCTCACTTGCTTATTGCAAAATCTAAAGTAGCTCCATTAAAAGTTCTTACTGTCAACCGATTGGAGCTATGTAGTGCTGTATTACTAGCAAAAATATTGAAGCATATTAGTAATTTACTAAATGAAACTCAAACCTCAAACATAACAATTTCAAAGATATGGGCATTCACTGATAGCTCAACTGTACTATCATGGCTGCAAACAGCACCTCATCGTCTTAAAACTTTCGTTGCACACCGTGTCGTGAAGCTGTTAGATAATTTGTCTGTCGAAAATTGGTATTACGTGCCAACGTATGATAATCCAGCAGATTACTGCAGTCGTGGTCTTACCTGCTCTCAGCTTGTGGCTTGTTCCACTTGGTGGACAGGACCCAAATGGATAATCTCGAATTCTTCTACATGGCCGGTGTCTGAAAAATTACCTTATCTAAAGGAATTAGCCGAAGTAAAATCCAGCTTCTTGTGCCATGTTCTTTTGGAATCTTCTAACAATAGTATTCTAACTCAGTTAATTGAAAAGTACTCTTCATTGTTGAGGCTACAACGCATCTTTGCCTGGTGTCGACGTTTTATTGCAAACGCAAATCGTCCGCCAGAAAAACGTATCAAATCTTTTTTAACTTTTACAGAACTAGAATACTCTCTATTTACCATTGTAAAACATGTTCAATCTCTTACATTCGCTAGCGAAATTAGTGCAATTAAAAGTGGAAAATCTTGTTCTCGCACTATAATAAAGTTAGCGCCAATTCTCGATCAACGGGGTCTGTTACGAGTGGGGGGACGATTAAAAAATGCAAACTTGCCACAATCAGCTATAAATCCGTTATTGTTGCCAAAAACCTTCCACCGTTGGAATGGCGTATCGGCAGAATTAGCATAA
Protein
MPATNLPSNLRESFKHLVLADENFDKPSNVDLLLGAELFHSIYDGQRVQPSHDLPVALHSVFGWVITGKLDTNHLPPPTISSLLASTRSLDEGLKRFWEIEEPPSQVILNPEDIKCEQMYSNLTYRNPDGRYVVPMLLKEPISQLGDSFNQSFSRLVNLERRLNRNLELKKEYTAFMREYKLLGHMEPSADSNKIGQYIIPHHCVIRPESTTTKLRVVFDASAKTTNGKSLNDLVYTGPKLQNDIGDILTKFRLHAVVFTADISKMYRNIELRPEDRKWQHILWRDSPSDPVTEYELKTVTYGVTSSPYLAIRTLHQLASDYEKEWPLAAASLRHDTFMDDITVGATSIETALKHKEELIQMLARAKFELRKWSSNSPEFITQIPTEHCQVPKTFCDEKQKQSIKILGVQWDPADDNFTYALSELTPGNTKRAILSNVARIYDPLGWLAPMVLIAKLTLQELWRLQLDWDETVPSDMLSQWHLFTSEFHYLKDIKIPRLIVPLHSKSYELVGFCDGSTKAYGCSVYLRITTDSEITSHLLIAKSKVAPLKVLTVNRLELCSAVLLAKILKHISNLLNETQTSNITISKIWAFTDSSTVLSWLQTAPHRLKTFVAHRVVKLLDNLSVENWYYVPTYDNPADYCSRGLTCSQLVACSTWWTGPKWIISNSSTWPVSEKLPYLKELAEVKSSFLCHVLLESSNNSILTQLIEKYSSLLRLQRIFAWCRRFIANANRPPEKRIKSFLTFTELEYSLFTIVKHVQSLTFASEISAIKSGKSCSRTIIKLAPILDQRGLLRVGGRLKNANLPQSAINPLLLPKTFHRWNGVSAELA

Summary

EMBL
GALX01004947    JAB63519.1    ABLF02001506    ABLF02008029    ABLF02035899    ABLF02037719    + More
ABLF02046327    ABLF02064627    ABLF02066034    ABLF02030854    ABLF02067347    GGMR01018294    MBY30913.1    LBMM01012238    KMQ86334.1    ABLF02026240    ABLF02055027    GBHO01030122    GBHO01030121    GBHO01030120    GBHO01030116    JAG13482.1    JAG13483.1    JAG13484.1    JAG13488.1    GEBQ01022991    GEBQ01006185    JAT16986.1    JAT33792.1    ABLF02035780    GEBQ01007199    GEBQ01000222    JAT32778.1    JAT39755.1    ABLF02039606    GBHO01027036    GBHO01010996    GBHO01010995    GBHO01010993    GBHO01010991    JAG16568.1    JAG32608.1    JAG32609.1    JAG32611.1    JAG32613.1    GGMR01014165    MBY26784.1    ABLF02005251    ABLF02055296    ABLF02006304    ABLF02036268    GEBQ01015737    JAT24240.1    GGMR01017890    MBY30509.1    GALX01000776    JAB67690.1    GEBQ01028569    JAT11408.1    GFTR01008866    JAW07560.1    GGMS01009443    MBY78646.1    ABLF02032595    ABLF02032597    GEBQ01015458    JAT24519.1    GEBQ01000825    JAT39152.1    ABLF02008594    GBHO01044317    GBHO01044315    JAF99286.1    JAF99288.1    GDHC01006469    JAQ12160.1    GBHO01044316    JAF99287.1    ABLF02025193    ABLF02041762    GANO01004788    JAB55083.1    GEZM01054765    JAV73413.1    GEZM01054766    JAV73410.1    ABLF02005684    GGMR01006575    MBY19194.1    GGMR01016460    MBY29079.1    GBHO01039838    GBHO01006034    JAG03766.1    JAG37570.1    GEZM01085145    GEZM01085143    JAV60187.1    GBHO01031928    GBHO01031926    JAG11676.1    JAG11678.1    GBHO01004196    JAG39408.1    GBBI01004276    JAC14436.1    GBHO01038805    GBHO01038804    GBHO01038801    JAG04799.1    JAG04800.1    JAG04803.1    GDHC01014268    JAQ04361.1    GGMS01010524    MBY79727.1    GBHO01006408    JAG37196.1    GDHC01014057    JAQ04572.1    ABLF02003339    ABLF02058001    ABLF02030698    ABLF02030705    ABLF02030709    GEBQ01005223    JAT34754.1    GGMR01003897    MBY16516.1    GBRD01007977    JAG57844.1    GDHC01011948    JAQ06681.1    GDHC01016272    JAQ02357.1    ABLF02028666    ABLF02066713    ABLF02008635    ABLF02023121    ABLF02065930    ABLF02065931    GAMC01006864    JAB99691.1    GDHC01002235    JAQ16394.1    GEZM01066274    JAV68017.1    ABLF02004035    ABLF02004036    ABLF02004037    ABLF02004038    ABLF02008018    ABLF02008020    ABLF02012635    ABLF02061171    ABLF02008636    GBHO01012499    GBHO01012498    GBHO01012497    GBHO01007479    GBHO01007451    GBHO01007450    JAG31105.1    JAG31106.1    JAG31107.1    JAG36125.1    JAG36153.1    JAG36154.1    ABLF02041863    ABLF02021785    GBHO01023090    JAG20514.1    LNIX01000016    OXA46198.1    GBHO01037676    JAG05928.1    LBMM01009202    KMQ88311.1    GAMC01020552    JAB86003.1    GGMS01014951    MBY84154.1    GGMR01013370    MBY25989.1    GBHO01039691    GBHO01039690    JAG03913.1    JAG03914.1    GBHO01034065    GBHO01034061    JAG09539.1    JAG09543.1    GGMR01010723    MBY23342.1    GEZM01066272    JAV68024.1    LNIX01000069    OXA36894.1    GGMR01003717    MBY16336.1    GGMR01005823    MBY18442.1    ABLF02003736    ABLF02008292    ABLF02008294    ABLF02046909    ABLF02052378    GBHO01007689    JAG35915.1    GEZM01018702    JAV90048.1    GBHO01038800    JAG04804.1    ABLF02067195    GGMR01002421    MBY15040.1    GDHC01018192    JAQ00437.1    ABLF02041614    GDHC01019528    JAP99100.1    ABLF02036131    ABLF02041527    ABLF02064049    LNIX01000011    OXA48901.1    GGMR01011131    MBY23750.1    GBHO01008418    GBHO01008416    JAG35186.1    JAG35188.1    LNIX01000007    OXA51795.1   
Pfam
PF18701   DUF5641        + More
PF05380   Peptidase_A17
PF03564   DUF1759
PF05585   DUF1758
PF17921   Integrase_H2C2
PF00665   rve
PF00078   RVT_1
Interpro
IPR001584   Integrase_cat-core        + More
IPR008042   Retrotrans_Pao       
IPR012337   RNaseH-like_sf       
IPR008737   Peptidase_asp_put       
IPR040676   DUF5641       
IPR005312   DUF1759       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR021109   Peptidase_aspartic_dom_sf       
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
IPR001969   Aspartic_peptidase_AS       
IPR000477   RT_dom       
IPR017907   Znf_RING_CS       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
SSF50630   SSF50630       
Gene 3D
PDB
4OL8     E-value=0.056695,     Score=88

Ontologies

Topology

Length:
830
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00243
Exp number, first 60 AAs:
8e-05
Total prob of N-in:
0.00004
outside
1  -  830
 
 

Population Genetic Test Statistics

Pi
205.835364
Theta
149.988385
Tajima's D
2.068554
CLR
0.395395
CSRT
0.893305334733263
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号