SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03540
Pre Gene Modal
BGIBMGA005709
Annotation
T18197_reverse_transcriptase-like_protein_-_silkworm
Full name
Retrovirus-related Pol polyprotein from type-1 retrotransposable element R2       + More
Retrovirus-related Pol polyprotein from type-2 retrotransposable element R2DM      
Alternative Name
Retrovirus-related Pol polyprotein from type I retrotransposable element R2
Retrovirus-related Pol polyprotein from type II retrotransposable element R2DM
Location in the cell
Nuclear   Reliability : 3.005
 

Sequence

CDS
ATGGACGCCGTTCCAATATGGCGGACTAGAGCGGAGTACGCGCGTGTGCAGGAACTGTACAAGAAGTGTCGCAGCAGAGCAGCAGCTGAAGTGATCGATGGCGCGTGTGGGGGTGTCGGACACTCGCTCGAGGAGATGGAGACCTATTGGCGACCTATCCTCGAGAGAGTGTCCGATGCACCTGGGCCTACACCGGAAGCTCTTCACGCCCTAGGGCGTGCGGAGTGGCACGGGGGCAATCGCGACTACACCCAGCTGTGGAAGCCGATCTCGGTGGAAGAGATCAAGGCCTCCCGCTTTGACTGGCGAACTTCGCCGGGCCCGGACGGTATACGTCCGGGTCAGTGGCGTGTGGTTCCTGTGCACTTCAAGGCGGAAATGTTCAATGCATGGATGGCACGAGGCGAAATACCCGAAATTCTACGGCAGTGCCGAACCGTCTTTGTGCCTAAGGTGGAGAGACCAGGTGGACCGGGGGAATATCGACCGATCTCGATCGCGTCGATTCCCCTGAGACACTTTCACTCCATCTTGGCCCGGAGGCTGTTGGCTTGCTGCCCCCCTGACGCACGACAGCGTGGATTTATCTGCGCCGACGGTACGCTGGAGAATTCCGCAGTACTGGACGCGGTGCTTGGGGATAGCAGGAAGAAGCTGCGGGAATGTCACGTGGCGGTGCTAGACTTCGCCAAGGCATTTGACACTGTGTCTCACGAGACACTTGTCGAATTGCTGAGGTTGAGGGGCATGCCCGAACAGTTCTGCGGCTACATTGCTCACCTATACGATACGGCGTCCACCACCTTAGCCGTGAACAATGAAATGAGCAGCCCTGTGAAAGTGGGACGAGGGGTTCGTCAAGGGGACCCTCTGTCGCCGATACTCTTCAACGTGGTGATGGACCTCATCCTGGCTTCCCTGCCGGAGAGGGTCGGGTATAGGAAAAGCGCGGTTCTGTCTATGATACCGGATGGCCACCGCAAGAAGCATCACTACCTGACTGAGCGAACCTTCAATATTGGAGGTAAGCCGCTCAGGCAGGTAAGTTGTGTTGAGCGGTGGCGATATCTTGGTGTCGATTTTGAGGCCTCTGGATGCGTGACATTAGAGCATAGTATCAGTAGTGCTCTGAATAACATCTCAAGGGCACCTCTCAAACCCCAACAGAGGTTGGAGATTTTGAGAGCTCATCTGATTCCGAGGTTCCAGCACGGTTTCGTGCTTGAAAACATCTCGGATGACAGATTGAGAATGCTCGATGTCCAAATCCGGAAAGCAGTCGGACAGTGGCTTAGGCTACCGGCGGATGTGCCCAAGGCATACTATCACGCCGCAGTTCAGGACGGCGGCTTAGCGATCCCATCGGTGCGAGCGACCATCCCGGACCTCATTGTGAGGCGTTTCGGGGGGCTCGACTCGTCACCATGGTCAGTGGCAAGAGCCGCCGCCAAATCTGATAAGATTCGTAAGAAACTGCGGTGGGCCTGGAAACAGCTTCGCAGGTTCAGCCGTGTTGACTCCACAACGCAACGACCATCAGTGCGCTTGTTTTGGCGAGAAAATCTGCACGCATCTGTTGATCGCGAAGTTCGCGAATCCACACGCACCCCGACATCCACAAAGTGGATTAGGGCGCGATGCGCGCAGATAACCGGACGGGACTTCGTGCAGTTCGTGCACACTCATATCAACGCCCTCCCATCCCGCATTCGCGGATCGAGAGGGCGTAGAGGTGGGGGTGAGTCTTCGTTGACCTGCCGTGCTGGTTGCAAGGTTAGGGAGACGACGGTTCACATCCTACAACAGTGTCACAGAACACACGGCGGCCGGATTCTACGACACAACAAGATTGTATCTTTCGTGGCGAAAGCCATGGAAGAGAACAAGTGGACGGTTGAGCTGGAGCCGAGGCTACGAACATCGGTTGGTCTCCGTAAGCCGGATATTATCGCCTCCAGGGATGGTGTCGGAGTGATCGTGGACGTGCAGGTGGTCTCGGGCCAGCGATCGCTTGACGAGCTCCACCGTGAGAAACGTAATAAATACGGGAATCACGGGGAGCTGGTTGAGTTGGTCGCAGGTAGACTAAGACTTCCGAAAGCTGAGTGCGTGCGAGCCACTTCGTGTACTGTATCTTGGAGGGGAGTTTGGAGCCTGACTTCTTATAAGGAGTTAAGGTCCATAATCGGGCTTCGGGAACCGACACTACAGATCGTTCCGATATTGGCGTTGAGAGGATCGCACATGAACTGGACCAGGTTCAATCAGATGACGTCCGTCATGGGGGGCGGCGTTGCAACAGAAACACCTGAGCAACATGATACCAGGTTAATAGCACAACGTGAGAGACAAAGGCAGCTGGTAGAGTCAGAAACACCTGAGCGTCATGAGTGCAGGCTAGCATCACAACGTGACAGACGAAGAGAGCTAATAGCGTCAGAAACACCCGAGCGTCATGAGTCCAGGCTAGCATCACAACGTGACAGACAAAGAGAGTTGTTAGCATCAGAAACATCTGAGCGTCATGAGTCTAGGCTAGCACCACAACGTGACAGACGAAGAGAGCTAATAGCGTCAGAAACACTTGAGCGTCATGAGTCCAGGCTAAGATTACAACGTAACAGACAAATAGAGCTATTAGCGTCAGAAACACCTGAGCAACATGAGGCCAGGTTAACAGGACGGCGTGAGAGACGAAAGGAGTTAGAAGCTTCAGAAACACCTGAGCAACGCCACGACAGGTTAAATAGCCAACGTGAGCGTGCACAGCAACGCAGAGCTGAAAATCATGTACAAGCGTTTGAAAATGCCATTAACACATCGTGTATACACGTTTGTGACATTTGCACGAAGCATTGA
Protein
MDAVPIWRTRAEYARVQELYKKCRSRAAAEVIDGACGGVGHSLEEMETYWRPILERVSDAPGPTPEALHALGRAEWHGGNRDYTQLWKPISVEEIKASRFDWRTSPGPDGIRPGQWRVVPVHFKAEMFNAWMARGEIPEILRQCRTVFVPKVERPGGPGEYRPISIASIPLRHFHSILARRLLACCPPDARQRGFICADGTLENSAVLDAVLGDSRKKLRECHVAVLDFAKAFDTVSHETLVELLRLRGMPEQFCGYIAHLYDTASTTLAVNNEMSSPVKVGRGVRQGDPLSPILFNVVMDLILASLPERVGYRKSAVLSMIPDGHRKKHHYLTERTFNIGGKPLRQVSCVERWRYLGVDFEASGCVTLEHSISSALNNISRAPLKPQQRLEILRAHLIPRFQHGFVLENISDDRLRMLDVQIRKAVGQWLRLPADVPKAYYHAAVQDGGLAIPSVRATIPDLIVRRFGGLDSSPWSVARAAAKSDKIRKKLRWAWKQLRRFSRVDSTTQRPSVRLFWRENLHASVDREVRESTRTPTSTKWIRARCAQITGRDFVQFVHTHINALPSRIRGSRGRRGGGESSLTCRAGCKVRETTVHILQQCHRTHGGRILRHNKIVSFVAKAMEENKWTVELEPRLRTSVGLRKPDIIASRDGVGVIVDVQVVSGQRSLDELHREKRNKYGNHGELVELVAGRLRLPKAECVRATSCTVSWRGVWSLTSYKELRSIIGLREPTLQIVPILALRGSHMNWTRFNQMTSVMGGGVATETPEQHDTRLIAQRERQRQLVESETPERHECRLASQRDRRRELIASETPERHESRLASQRDRQRELLASETSERHESRLAPQRDRRRELIASETLERHESRLRLQRNRQIELLASETPEQHEARLTGRRERRKELEASETPEQRHDRLNSQRERAQQRRAENHVQAFENAINTSCIHVCDICTKH

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Keywords
Complete proteome   Endonuclease   Hydrolase   Metal-binding   Nuclease   Nucleotidyltransferase   Reference proteome   RNA-directed DNA polymerase   Transferase   Transposable element   Zinc   Zinc-finger   Aspartyl protease   Protease  
Feature
chain  Retrovirus-related Pol polyprotein from type-1 retrotransposable element R2
EMBL
M16558    AAB59214.1    AB076841    BAC01114.1    AF436853    AAQ04479.1    + More
GBBI01004849    JAC13863.1    GBYB01008309    JAG78076.1    LBMM01006940    KMQ90176.1    AAZX01002322    KQ971997    KYB24671.1    LBMM01007077    KMQ90064.1    L00950    AAZX01010802    AAZX01015897    GGMS01004512    MBY73715.1    FJ461304    ACJ71597.1    GBBI01004906    JAC13806.1    X51967    GBBI01004905    JAC13807.1    GFJQ02001120    JAW05850.1    GFAC01000014    JAT99174.1    GEDV01005279    JAP83278.1    AAZX01024756    AAZX01024918    JQ082370    AFM44926.1    GFWV01002964    MAA27694.1    GACK01007407    JAA57627.1    GFTR01008394    JAW08032.1    GEDV01003881    JAP84676.1    AAZX01023287    AF015819    AAC34906.1    AAZX01023288    KF925878    AHN53448.1    LBMM01009160    KMQ88340.1    AF015815    AAC34903.1    GFAC01005513    JAT93675.1    GFAC01005869    JAT93319.1    GFWV01001114    MAA25844.1    GFJQ02003336    JAW03634.1    AB097122    BAC82590.1    AF015685    AAB94032.1    EU854578    ACJ46647.1    KJ958674    AIL01110.1    GFWV01012635    MAA37364.1    AB097121    BAC82589.1    JN937617    AFO19996.1    L00951    JN937619    AFO19998.1    KQ972640    KXZ75830.1    ABLF02003433    GBHO01045037    GBHO01045036    JAF98566.1    JAF98567.1    GBRD01016678    JAG49149.1    GDHC01017848    JAQ00781.1    JN937618    AFO19997.1    UZAN01004728    VDP32110.1    AB097123    BAC82591.1    KK855758    PTY23787.1    GBRD01002048    JAG63773.1    JN937616    AFO19995.1    FN356223    CAX83712.1    KL596651    KER31070.1    AHAT01035183    L00947    LC155026    BAX24488.1    AHAT01017236    AHAT01017237    LC349444    BBC20536.1    JYDL01000257    KRX12851.1    JYDI01000477    KRY44798.1   
Pfam
PF00078   RVT_1        + More
PF00096   zf-C2H2
PF08356   EF_assoc_2
PF08355   EF_assoc_1
PF00071   Ras
PF13202   EF-hand_5
PF00249   Myb_DNA-binding
Interpro
IPR013087   Znf_C2H2_type        + More
IPR000477   RT_dom       
IPR013567   EF_hand_assoc_2       
IPR018247   EF_Hand_1_Ca_BS       
IPR020860   MIRO_dom       
IPR013566   EF_hand_assoc_1       
IPR036236   Znf_C2H2_sf       
IPR027417   P-loop_NTPase       
IPR001806   Small_GTPase       
IPR011992   EF-hand-dom_pair       
IPR002048   EF_hand_dom       
IPR001005   SANT/Myb       
SUPFAM
SSF57667   SSF57667        + More
SSF52540   SSF52540       
SSF47473   SSF47473       

Ontologies

Topology

Length:
952
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00757999999999999
Exp number, first 60 AAs:
0.00075
Total prob of N-in:
0.00036
outside
1  -  952
 
 

Population Genetic Test Statistics

Pi
16.169337
Theta
18.998678
Tajima's D
1.203107
CLR
0.044842
CSRT
0.725213739313034
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号