SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03538
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.935
 

Sequence

CDS
ATGTGGTTCCACAGGCCCCGGAGAGTGCCACCTGTCGATGCCCATATCGTGGTTGGAGGCGTCCGTATCGGGGTCGGGGTGCAGTTGAAGTACCTCGGCCTCATTCTGGACAGTCGTTGGACCTTCCGTGCTCACTTTCAAAATCTTGTCCCTCGTCTGTTGGGGGTGGCCGGCGCGTTAAGCCGGCTTCTTCCCAACGTTGGGGGGCCTGACCAGGTGACGCGCCGTCTCTATACAGGGGTGGTGCAATCAATAGCCCTATACGGGGCGCCCGTGTGGGGCCAGTCCCTGGCCGTGGGGGTAGCGAAGCTGCTGCAACGGCCGCAACGCACCATCGCGGTCAGGGTCATCCGCGGCTATCGCACCATCTCCTTCGAGGCGGCGTGTGTACTGGCTGGGACGCCGCCTTGGGTTCTTGAGGCGGAGGCGCTCGCCGCTGACTATCAGTGGCGGGCTGACCTTCGTGCACGGGGCGTGGCACGTCCCAGCCCCAGTGTGGTCAGAGCGCGGAGGGCCCAATCTCGGCGGTCCGTGCTGGAGTCATGGTCCAGACGGCTGGCCGATCCTTCGGCTGGTCGTAGGACCGTCGAGGCGATTCGCCCGGTTCTTGTGAATTGGGTGAATCGTGACAGAGGACGCCTCACTTTCCGGCTCACGCAAGTGCTCACTGGGCATGGTTGCTTCGGTGAGTTCCTGCACCGGATCGGAGCCGAGCTGACGGCAGAGTGCCACCATTGTGGTTGCGACTTGGACACGGCGGAGCACACGCTCGTCGCCTGCCCCGCATGGGAGGGGTGGCGCCGTGTCCTTGTCGCAAAAATAGGAAACGACTTGTCGTTGCCGGGTGTTGTGGCATCAATGCTCGGTGACGACGAGTCGTGGAAGGCGATGCTCGACTTCTGCGAGTGCACCATCTCACAGAAGGAGGCGGCAGGGCGCGTGCGGGACGCGCAGGCCCGCCGCCGTCGAGCGGGGGCCAGGGAGGCGGATTTCGCCCAAGCCCTGGCCCTCTAA
Protein
MWFHRPRRVPPVDAHIVVGGVRIGVGVQLKYLGLILDSRWTFRAHFQNLVPRLLGVAGALSRLLPNVGGPDQVTRRLYTGVVQSIALYGAPVWGQSLAVGVAKLLQRPQRTIAVRVIRGYRTISFEAACVLAGTPPWVLEAEALAADYQWRADLRARGVARPSPSVVRARRAQSRRSVLESWSRRLADPSAGRRTVEAIRPVLVNWVNRDRGRLTFRLTQVLTGHGCFGEFLHRIGAELTAECHHCGCDLDTAEHTLVACPAWEGWRRVLVAKIGNDLSLPGVVASMLGDDESWKAMLDFCECTISQKEAAGRVRDAQARRRRAGAREADFAQALAL

Summary

EMBL
AB090825    BAC57926.1    AB126050    BAD86650.1    KZ150386    PZC71062.1    + More
AB078935    BAC06462.1    AB078930    BAC06454.1    AB078931    BAC06456.1    KZ150308    PZC71477.1    KZ149896    PZC78733.1    AB078929    BAC06452.1    D85594    BAA19776.1    KZ149950    PZC76665.1    LBMM01008861    KMQ88580.1    LBMM01012027    KMQ86470.1    LBMM01009494    KMQ88097.1    GL450953    EFN80213.1    LBMM01014132    KMQ85305.1    LBMM01005707    KMQ91279.1    LBMM01003679    KMQ93242.1    LBMM01006671    KMQ90407.1    LBMM01006657    KMQ90417.1    LBMM01006954    KMQ90166.1    LBMM01019839    KMQ83438.1    KQ414641    KOC66782.1    LBMM01019838    KMQ83439.1    LBMM01005634    KMQ91349.1    QOIP01000010    RLU18098.1    LBMM01005733    KMQ91252.1    LBMM01008682    KMQ88705.1    LBMM01004272    KMQ92618.1    QOIP01000031    RLU14697.1    LBMM01008349    KMQ88951.1    LBMM01002052    KMQ95336.1    LBMM01015018    KMQ84954.1    LBMM01004634    KMQ92224.1    LBMM01006063    KMQ90967.1    LBMM01006909    KMQ90209.1    QOIP01000007    RLU20280.1    LBMM01006725    KMQ90373.1    LBMM01007036    KMQ90099.1    LBMM01015025    KMQ84953.1    LBMM01020849    KMQ83202.1    LBMM01004505    KMQ92346.1    LBMM01005216    KMQ91703.1    GGMR01016864    MBY29483.1    GGMR01011974    MBY24593.1    LBMM01003988    KMQ92922.1    LBMM01005948    KMQ91066.1    LBMM01003245    KMQ93755.1    KZ149989    PZC75622.1    ABLF02005203    ABLF02041316    LBMM01006110    KMQ90925.1    LBMM01009738    KMQ87908.1    LBMM01007425    KMQ89740.1    GGMR01014918    MBY27537.1    LBMM01002480    KMQ94776.1    LBMM01014909    KMQ85000.1    LBMM01007659    KMQ89538.1    LBMM01012595    KMQ86127.1    GGMR01015354    MBY27973.1    LBMM01004697    KMQ92167.1    GGMR01006442    MBY19061.1    GFXV01001748    MBW13553.1    ABLF02004597    ABLF02041324    LBMM01021647    KMQ83033.1    LBMM01008422    KMQ88894.1    GGMR01019609    MBY32228.1    GGMS01012744    MBY81947.1    ABLF02004854    ABLF02041317    LBMM01014956    KMQ84982.1    ABLF02041886    ABLF02011238    ABLF02015311    ABLF02015320    ABLF02034009    ABLF02043484    GGMR01012534    MBY25153.1    ABLF02017307    LBMM01012412    KMQ86235.1    ABLF02016435    ABLF02016436    ABLF02064751    GGMR01005740    MBY18359.1    LBMM01014122    KMQ85315.1    GBHO01002982    JAG40622.1    GFXV01003903    MBW15708.1    GALX01004785    JAB63681.1    GGMR01015159    MBY27778.1    GFXV01002090    MBW13895.1    GGMR01012877    MBY25496.1    GFXV01002242    MBW14047.1    LBMM01005465    KMQ91492.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF01553   Acyltransferase
PF03372   Exo_endo_phos
PF17919   RT_RNaseH_2
PF00098   zf-CCHC
PF13843   DDE_Tnp_1_7
PF05699   Dimer_Tnp_hAT
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR002123   Plipid/glycerol_acylTrfase       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR013087   Znf_C2H2_type       
IPR041577   RT_RNaseH_2       
IPR029526   PGBD       
IPR037220   BED_dom       
IPR012337   RNaseH-like_sf       
IPR008906   HATC_C_dom       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
SSF53098   SSF53098       
SSF140996   SSF140996       
Gene 3D

Ontologies

Topology

Length:
337
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
2.04993
Exp number, first 60 AAs:
0.5023
Total prob of N-in:
0.07782
outside
1  -  337
 
 

Population Genetic Test Statistics

Pi
33.434359
Theta
29.716905
Tajima's D
1.520338
CLR
1.685133
CSRT
0.791210439478026
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号