SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03536  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA006251
Annotation
PREDICTED:_zonadhesin-like_isoform_X1_[Bombyx_mori]
Location in the cell
Extracellular   Reliability : 2.698
 

Sequence

CDS
ATGAAATGTCCGGTGCCCGCCAAATGTAGACCTACTTGCTCTGTGCCGAATCCACCGAACTGTCCACCTTACAAGCCGCCTACTGAGAACGAGGACGGATGTCGATGTCAACCAGGGTACATCTTGTCTGAAACAGAAGGGAAATGTGTTAAAATAGAAACCTGCCCTACTGGTCAGTGTCCGGTGCCCGCCAAATGTAGACCTACTTGCTCTGTGCCGAATCCACCGAACTGTCCACCTTACAAGCAGCCTACTGAGAACGAGGACGGATGTCGATGTCAACCAGGGTACATCTTGTCTGAAACAGAAGGGAAATGTGTTAAAATAGAAACCTGCCCTACTGGTCAGTGTCCGGTGCCCGCCAAATGTAGACCTACTTGCTCTGTGCCGAATCCACCGAACTGTCCACCTTACAAGCAGCCTACTGAGAACGAGGACGGATGTCGATGTCAACCAGGGTACATCTTGTCTGAAACAGAAGGGAAATGTGTTAAAATAGAAACCTGCCCTAGTTCGTGTTCTGGTAACGAAACGCGCGTATACTGCAAGGCTGGCTGTCCCACTGACTATTGTCCAACAAGCGACAGCCGCGCTGTAATTGCTTGCGATCCCCCCTACCCATGTAATCCGGGCTGCGTTTGTAAACCAAATTATCGACGCCTGAGTCAGGATGACGAGCGATGTGTGCTGACCACAGACTGTCCTCCAGTGAAGTGCACACGACCGAATGAAGTTTGGAATCCTTGTACACAATGTTTGGCGGAACGATGCGAGGATGCCAACAGTCCCTCTAACCTGAATTGTCCTCCTCAGCTGCGCCCTTATTGCAATCCGCAGTGCGTGTGTGCAAACGGTTATTACAGGAACAACAATGACGTTTGTGTCCCGAAGAAAGCTTGTCCTGGTCAGTGTCCGGTGCCCGCCAGGTGGAGACCTACCTGCTCTGTGCCGAATCCACCGAATTGTCCACCTTACAAGCCGCCTGCTGAGAACAAGGACGGATGTCAATGTCAAGAAGGGTACATCTTGTCTGAAGCAGAAGGAAAATGTATTAAAATAGAAGAATGTCCTAGAACATCAGGCTGTAATGGAGATCCACATGCAAAAGTGACGAAGTGTCCGTTACCTTGCCCGTCCACTTGCAAATCACCAGAGGCTATAGGTTGTAAGAAAAGGTGCGATCCGGTTGGATGTGAATGCGAGTATGGCTACATACTATCAGATATAGGAGGAAAATGTATTAAGCCTGAAGAATGCCCAGGCGGAAACCCGTGTGGATCAAATGGTACATTTGTTAAATGCAAATCAAGGTGTCCGAATGACTATTGTCCTGTCAACGATAATCGTGGAGTTATAATTTGTGAAGGCTTTCCATTAGCCCCCTGTTACTCTGGATGTATTTGTAAGCTAAATTATAAAAGACGCAGCGAGACAGACCGAAGATGCATTCTGTCTACAGATTGCCCTCCTGTAAATTGCACTAGACCCAACGAAGTCTGGTGCCCGTCACCACCGCCCTGTTTACAAGAAACCTGCGATGATGTCGACCTTCCTCCGGTACCTTGTAACGAATTTATAAAAAGCAGTCCTAGATGCATCTGCAAAGATAATTACTTCAGGAACGATAGCGGAATCTGCGTTTGCGCTCAGGAATGTCGCGACATAAACGCGCCTGATTATAATCGCAAGAAGCGTGATATATTCATATGCTCCGCAACCGCGCACAATACAACTGAAGGTCCGTGCAATGCAAACGAAACGCTCGTATCCTGCAAAGCTGGCTGTCCCACCGACTATTGTCCAACAAGCGACAGCCGCGCTGTAGTTGCTTGCGATCCCCCCTACCCATGTAATCCGGGCTGCGTTTGTAAACCAAATTATAAGCTCTTGAGTCAGGATGACGAGCGATGTGTGCTAACCACAGACTGTCCTCCTGTAAATTGCACTAGACCCAATGAAGTCTGGAGCCCGTCACCACCGCCCTGTTTACAAGAAACCTGCGATGATGTCGACGTTACTCCGGTACCTTGTAACGAGTTTATACAAAGCAGCCCTAGATGCATCTGCAAAGATAATTACTTCAGGAACGATAGCGGAATCTGCGTTTCCGCTCAGGAATGTCGCGACATAAACGCGCGTGATTATAATCGCAAGAAGCGTGATATACCGGAATGTGGTTATAACGAAGTACTGTCGGATTCCAAAATAGTGTGTCCCCCTCAGACTTGTGAGAGCATATACACTACGTATTTATGTGAGTCTAGGGGTGATGAAGTTGGATGTAACTGTTTATCTGGATATTTGAGGAACAGCAGTGGTATATGCATTCCCAGTGAGGAATGTTTTCAAGCGGAGAATTGCTCGCTTCCTTCTGAATGTATACCGACATGCGCAATTCCGAATCCCAATTGTTCCTACGTTCAGGAAGTTTCCTTCAAAAGAGAAGCCTGTTATTGTAAGCCTGGTTTCATATTATCCGAGGTCAATGGGGAATGCATTAAGATCGAAAATTGTCCAAAACAACAATGCGGGGTAAACGGAACATATTCCGATTGCGGCTTTCGATGCCCAAACCAGTATTGTCCTGAAGACGACAGTTTACTCCAAATAGCGTGTAAGCCTGGGCGACCCTGCCCGCCTGGCTGCGTATGTAAGGATAACTACAAAAGAAAAAGTCGCGAAGAAGACGATGTTTGCGTACTCGCCTCAGATTGTCCACCCGTCAATTGCACTAGGCCTAATGAAGTTTGGAATCCCTGTTCGCAATGTTTGGCGGAACGATGCGAAGATGCTAACACTACTAATTGTTATGATCCGCCCGGCTCAAACTGTGACCCTAGGTGCGTGTGTGTAGATGGGTATAAAAGAAACAAAGATGACGTTTGCGTCCCGGAGAAAGCGTGTCCTGGTCGATGTCCGATACCGATTAAATGTAGACCGACATGTGCTGTTCCTAATCCAAAAAAATGTTCTAAGTATAAATTACCTGCCAACAATGAGGATGGGTGTCAATGTAAGAAAGGATACATTTTGTCGGAACTCGATGGGAAATGTGTTGCAATCGACAAATGTCCCAAAATGGGAGGTTGCAACGGTGATCCGCATGCGGTAATAAAAGAATGTCCGTTGGCTTGTCCGTCTACTTGTGAGGCACCGGAGGCTAAGCCCTGTAAAAAGAAATGTGCTCCTGTCGGATGCGAATGCGAATCTGGTTATATACTTTCGAAAACAAAAGGCAAATGTATCAGCCCCGAAGAATGCCCAGGCTAG
Protein
MKCPVPAKCRPTCSVPNPPNCPPYKPPTENEDGCRCQPGYILSETEGKCVKIETCPTGQCPVPAKCRPTCSVPNPPNCPPYKQPTENEDGCRCQPGYILSETEGKCVKIETCPTGQCPVPAKCRPTCSVPNPPNCPPYKQPTENEDGCRCQPGYILSETEGKCVKIETCPSSCSGNETRVYCKAGCPTDYCPTSDSRAVIACDPPYPCNPGCVCKPNYRRLSQDDERCVLTTDCPPVKCTRPNEVWNPCTQCLAERCEDANSPSNLNCPPQLRPYCNPQCVCANGYYRNNNDVCVPKKACPGQCPVPARWRPTCSVPNPPNCPPYKPPAENKDGCQCQEGYILSEAEGKCIKIEECPRTSGCNGDPHAKVTKCPLPCPSTCKSPEAIGCKKRCDPVGCECEYGYILSDIGGKCIKPEECPGGNPCGSNGTFVKCKSRCPNDYCPVNDNRGVIICEGFPLAPCYSGCICKLNYKRRSETDRRCILSTDCPPVNCTRPNEVWCPSPPPCLQETCDDVDLPPVPCNEFIKSSPRCICKDNYFRNDSGICVCAQECRDINAPDYNRKKRDIFICSATAHNTTEGPCNANETLVSCKAGCPTDYCPTSDSRAVVACDPPYPCNPGCVCKPNYKLLSQDDERCVLTTDCPPVNCTRPNEVWSPSPPPCLQETCDDVDVTPVPCNEFIQSSPRCICKDNYFRNDSGICVSAQECRDINARDYNRKKRDIPECGYNEVLSDSKIVCPPQTCESIYTTYLCESRGDEVGCNCLSGYLRNSSGICIPSEECFQAENCSLPSECIPTCAIPNPNCSYVQEVSFKREACYCKPGFILSEVNGECIKIENCPKQQCGVNGTYSDCGFRCPNQYCPEDDSLLQIACKPGRPCPPGCVCKDNYKRKSREEDDVCVLASDCPPVNCTRPNEVWNPCSQCLAERCEDANTTNCYDPPGSNCDPRCVCVDGYKRNKDDVCVPEKACPGRCPIPIKCRPTCAVPNPKKCSKYKLPANNEDGCQCKKGYILSELDGKCVAIDKCPKMGGCNGDPHAVIKECPLACPSTCEAPEAKPCKKKCAPVGCECESGYILSKTKGKCISPEECPG

Summary

Similarity
Belongs to the serpin family.
Pfam
PF01826   TIL        + More
PF00079   Serpin
Interpro
IPR036084   Ser_inhib-like_sf        + More
IPR002919   TIL_dom       
IPR006212   Furin_repeat       
IPR000742   EGF-like_dom       
IPR042185   Serpin_sf_2       
IPR042178   Serpin_sf_1       
IPR023796   Serpin_dom       
IPR036186   Serpin_sf       
IPR004094   Antistasin-like       
IPR017896   4Fe4S_Fe-S-bd       
IPR003645   Fol_N       
SUPFAM
SSF57567   SSF57567        + More
SSF56574   SSF56574       
Gene 3D

Ontologies

Topology

Length:
1089
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00001
outside
1  -  1089
 
 

Population Genetic Test Statistics

Pi
212.498845
Theta
175.630191
Tajima's D
0.561912
CLR
0.43243
CSRT
0.530673466326684
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
26822097 NNNDVCVPKNACPGQCPVPAR 95.45 4e-08
26822097 GYIISEIDGK 100.00 6e-08
25860555 DEVSDNRFPR 100.00 6e-08
28467696 AVTNISNVIK 100.00 6e-08
29197581 AGCPTDYCPTSDSR 100.00 6e-08
26822097 KIIIFFN 100.00 2e-07
26822097 CPIPCPSTCK 95.24 2e-07
26822097 SPEAIGCK 95.24 2e-06
26822097 QACPGQCPVPAR 100.00 0.003
26822097 RCDPVGCECEYGYIISDIGGK 100.00 0.008
26822097 PTCSVPNPPNCPPYK 100.00 0.011
26822097 PTCSVPNPPNCPPYK 100.00 0.011
25860555 NVGIAIGR 100.00 0.011
25860555 NVGIAIGR 100.00 0.011
27102218 YKIPANNEDGCQCKK 100.00 0.011
27102218 YKIPANNEDGCQCKK 100.00 0.011
29197581 ECPIACPSTCEAPEAKPCK 100.00 0.011
29197581 ECPIACPSTCEAPEAKPCK 100.00 0.011
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号