SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03528
Annotation
PREDICTED:_LOW_QUALITY_PROTEIN:_uncharacterized_protein_LOC105841899?_partial_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.273
 

Sequence

CDS
ATGCAGAACGAAGGAGGCGGCGAGACTTCTCTGGAACGCATTCTGGCGGCCCGCATCATTCAGCATCTGGTCAGGGTGGGACCCGATCTGTCGGCGGAGCAGTATGGCTTCCGAGAGGGCCGCTCAACAGTAGACGCGATCCTTCGCGTGCGGGCCCTCTCGGAGGAGGCCGTCTCCAGGGGTGGGGTGGCTTTGGCGGTGTCGCTCGACATCGCCAATGCGTTTAACACCCTGCCCTGGTCCGTGATAGGGGGGGCGCTGGAACGACATGGAGTGCCTCCCTACCTCCGCCGGCTGGTGGGTTCCTACTTGGAGGACAGATCGGTCACGTGTACCGGACACGGTGGGATCCTGCACCGGTTCCCGGTCGTGCGCGGTGTTCCACAGGGGTCGGTGCTCGGCCCTCTTTTGTGGAATATCGGGTATGACTGGGTGCTAAGGGGTGCCCTCCTCCCGGGCTTGAGCGTAATCTGTTACGCAGACGACACGTTAGTCGTGGCCCGGGGGGGGAGTTTTGCTGAGTCTGCCCGTCTTGCTACCGCTGGGGCCCCGGAGAGTGCCACCTGTCGATGCCCATATCGTGGTTGGAGGCGTCCGTATCGGGGTCGGGGTGCAGTTGAAGTACCTCGGCCTCATCCTGGACAGTCGTTGGACCTTCCGTGCTCACTTTCAGAACCTGGTCCCTCGTTTGTTGGGGGTGGCCGGCGCGTTAAGCCGGCTTCTGCCCAACGTCGGGGGCCTGACCAGGTGACGCGCCGTCTCTATACGGGGGTGGTGCGATCAATGGCCCTATACGGGGCACCTGTGTGGGGCCAGTCCCTGGCCGCGGGGGTGGCGAAGCTGCTGCAACGGCCGCAACGCACCATCGCGGTCAGGGTCATCCGTGGTTATCGCACCATCTCCTTTGAGGCGGCGTGTGTACTGGCTGGGACGCCGCCTTGGATTCTGGAAGCGGAGGCGCTCGCTGCTGACTATCAGTGGCGGGCTGACCTTCGTGCCCGGGGCGTGGCGCGTCCCAGCCCCTGTGTGGTCAGAGCGCGGAGGGCCCAATCTCGGCGGTCCGTGCTGGAGTCATGGTCCAGACGGCTGGCTGATCCTTCGGCCGGTCGTAGGACCGTCGAGGCGATTCGCCCGGTCCTTGTGGATTGGGTGAATCGTGACAGAGGACGCCTCACTTTCCGGCTCACGCAGGTGCTCACTGGGCATGGTTGCTTCGGTGAGTTCCTGCACCGGATCGGAGCCGAGCCGACGGCAGAGTGCCACCGTTGTGGTTGCGACTTGGACACGGCGGAGCACACGCTCGTTGCCTGCCCCGCATGGGAGGGGTGGCGCCGTGTCCTCGTCGCAAAAACAGGAAACGACTTGTCGTTGCCGAGTGTCGTGGCATCGATGCTCGGCGACGACGAGTCGTGGAAGGCGATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGCGTGAGAGACGCACAATCCCGCCGCCGTCGAGCGGGGGCCAGGGAGGCGGATCTCGCCCAAGCCCTGGCCCTCTAA
Protein
MQNEGGGETSLERILAARIIQHLVRVGPDLSAEQYGFREGRSTVDAILRVRALSEEAVSRGGVALAVSLDIANAFNTLPWSVIGGALERHGVPPYLRRLVGSYLEDRSVTCTGHGGILHRFPVVRGVPQGSVLGPLLWNIGYDWVLRGALLPGLSVICYADDTLVVARGGSFAESARLATAGAPESATCRCPYRGWRRPYRGRGAVEVPRPHPGQSLDLPCSLSEPGPSFVGGGRRVKPASAQRRGPDQVTRRLYTGVVRSMALYGAPVWGQSLAAGVAKLLQRPQRTIAVRVIRGYRTISFEAACVLAGTPPWILEAEALAADYQWRADLRARGVARPSPCVVRARRAQSRRSVLESWSRRLADPSAGRRTVEAIRPVLVDWVNRDRGRLTFRLTQVLTGHGCFGEFLHRIGAEPTAECHRCGCDLDTAEHTLVACPAWEGWRRVLVAKTGNDLSLPSVVASMLGDDESWKAMLDFCECTISQKEAAGRVRDAQSRRRRAGAREADLAQALAL

Summary

EMBL
AB078935    BAC06462.1    AB078931    BAC06456.1    AB078930    BAC06454.1    + More
AB078929    BAC06452.1    LBMM01012027    KMQ86470.1    KZ149896    PZC78733.1    D85594    BAA19776.1    LBMM01003679    KMQ93242.1    KZ150386    PZC71062.1    LBMM01024063    KMQ82623.1    LBMM01005733    KMQ91252.1    LBMM01006110    KMQ90925.1    LBMM01006063    KMQ90967.1    LBMM01008682    KMQ88705.1    LBMM01019838    KMQ83439.1    LBMM01019839    KMQ83438.1    LBMM01002052    KMQ95336.1    LBMM01005948    KMQ91066.1    LBMM01007036    KMQ90099.1    LBMM01015018    KMQ84954.1    LBMM01004634    KMQ92224.1    LBMM01003245    KMQ93755.1    LBMM01015025    KMQ84953.1    LBMM01003988    KMQ92922.1    LBMM01007425    KMQ89740.1    LBMM01006725    KMQ90373.1    LBMM01004505    KMQ92346.1    LBMM01008422    KMQ88894.1    LBMM01014956    KMQ84982.1    LBMM01008448    KMQ88867.1    LBMM01012412    KMQ86235.1    LBMM01006977    KMQ90149.1    LBMM01008162    KMQ89092.1    LBMM01014122    KMQ85315.1    LBMM01005216    KMQ91703.1    GGMR01000779    MBY13398.1    LBMM01002480    KMQ94772.1    LBMM01003575    KMQ93366.1    GGMR01014195    MBY26814.1    ABLF02014378    GFXV01002090    MBW13895.1    ABLF02011238    GGMR01015159    MBY27778.1    GFXV01003903    MBW15708.1    LBMM01012322    LBMM01012138    KMQ86282.1    KMQ86387.1    ABLF02059310    LBMM01006662    KMQ90413.1    GGMR01006838    MBY19457.1    LBMM01005845    KMQ91162.1    GGMR01009778    MBY22397.1    ABLF02005203    ABLF02041316    AB593326    BAK38647.1    ABLF02004854    ABLF02041317    ABLF02004597    ABLF02041324    KQ972691    KXZ75805.1    LBMM01015285    KMQ84870.1    GGMR01019493    MBY32112.1    GFXV01001748    MBW13553.1    ABLF02023401    ABLF02029423    ABLF02060278    GFXV01002242    MBW14047.1    GGFM01001554    MBW22305.1    GGFK01007771    MBW41092.1    QOIP01000031    RLU14697.1    GGFJ01001166    MBW50307.1    AB090820    BAC57916.1    ABLF02006132    QOIP01000010    RLU18098.1    LBMM01007659    KMQ89538.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF01553   Acyltransferase
PF03372   Exo_endo_phos
PF00098   zf-CCHC
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR002123   Plipid/glycerol_acylTrfase       
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
IPR016067   S-AdoMet_deCO2ase_core       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
SSF56276   SSF56276       
Gene 3D
PDB
6AR3     E-value=6.18369e-06,     Score=120

Ontologies

Topology

Length:
514
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.17974
Exp number, first 60 AAs:
0.00139
Total prob of N-in:
0.00677
outside
1  -  514
 
 

Population Genetic Test Statistics

Pi
245.603711
Theta
24.651443
Tajima's D
2.524575
CLR
0.498732
CSRT
0.949502524873756
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号