SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03527
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.333
 

Sequence

CDS
ATGCGTGCCCTACAACGCGACGTAAAGTCTCGCATCGCCGAAGTCCGAGATGCCAGATGGTCTGATTTCTTAGAAGGACTCGCACCCTCCCATAGGTCTTACTACCGCTTAGCTCGTACTCTCAAATCGGATACGGTAGTAACTATGCCCCCCCTCGTAGGCCCCTCAGGCCGACTCGCGGCGTTCGATGATGACGAAAAAGCAGAGCTGCTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCACTCAATCCGTGGACCCTGTTCATGTAGAATTAATAGACAGTGAGGTAGAACGCAGAGCCTCCTTGCCACCATCGGATGCGTTACCACCCGTCACCCCGATAGAAGTTAAAGACTTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACGGTATATCTAACCGCGTTATTAAACTTCTACCCGTCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCGAACTGTATCTTTCCCGCGGTAAACGGAGCGTACGTGGTGAAGAGAGACACACCATCGACCCCCCCGAATATATTTGAATCATTTCAAACAAACATGGACATGTTCAGGAAGTGCTTGGATTTAACGCTGGCCAAATCGGTGGACGATGTTAACGTGCATCAACTGAAACCTGTCTTTAATGTTATCGGTGATCAGATTAATAGATTTTCTAAAGCGTTCGAAGATTTGACCGCGAAAAGTACTACAACACAGGAATCGATTTGGGCGTAG
Protein
MRALQRDVKSRIAEVRDARWSDFLEGLAPSHRSYYRLARTLKSDTVVTMPPLVGPSGRLAAFDDDEKAELLADTLQTQCTPSTQSVDPVHVELIDSEVERRASLPPSDALPPVTPIEVKDLIKDLRPRKAPGSDGISNRVIKLLPVQLIVMLASIFNAAMANCIFPAVNGAYVVKRDTPSTPPNIFESFQTNMDMFRKCLDLTLAKSVDDVNVHQLKPVFNVIGDQINRFSKAFEDLTAKSTTTQESIWA

Summary

Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF03564   DUF1759
PF18701   DUF5641
PF00665   rve
PF05380   Peptidase_A17
PF17921   Integrase_H2C2
PF05585   DUF1758
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR005312   DUF1759       
IPR040676   DUF5641       
IPR008737   Peptidase_asp_put       
IPR008042   Retrotrans_Pao       
IPR012337   RNaseH-like_sf       
IPR001584   Integrase_cat-core       
SUPFAM
SSF56219   SSF56219        + More
SSF53098   SSF53098       
Gene 3D

Ontologies

Topology

Length:
250
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
16.58744
Exp number, first 60 AAs:
0.0192
Total prob of N-in:
0.34427
outside
1  -  250
 
 

Population Genetic Test Statistics

Pi
2.928025
Theta
35.057778
Tajima's D
-1.053662
CLR
0.348392
CSRT
0.127193640317984
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号