SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03523
Pre Gene Modal
BGIBMGA006240
Annotation
PREDICTED:_uncharacterized_protein_LOC106109531?_partial_[Papilio_polytes]
Location in the cell
Nuclear   Reliability : 3.764
 

Sequence

CDS
ATGGCAAGACGACGATCAAAAAGCCAGTCCTTCGATGACGACGACAGTATTTTCGATCGACCAACGCGTGGTGGAATGTTTCACTTAACGGAGAATATCATCAGGAAGTTTGACGGCAAAGACAAAACTTATGCTGTAACAAAGTGGATACAAGATATAGAGGAAAATGGTGACATATTCGAGTGGACACCAAAGCAACGGTTATTAGTGGCTCGACGGTCATTAACCGGCACGGCAGCTTTGTGGTTAAATTCTGAAAAAACGTTTCCATGCTGGGATACTTTAAAGATAGCCATCAGTAAGGAGTTCCCTGACACCATAGACGCCAAGACTATTCACGAAATGATGAGTGCTAAAAAGAAAAAGTCAAATGAATCATGCATTGACTACATGTTTGCCATGAAAGAGCTTGGACGCCGAGGCAAAATGGCGGACTACGTGGCTATAAAATATGTTGTAGATGGCATACAAGATCAAGAAATAAATAAAATAATGCTATATGGAGTCACAACGTACGCTGAATTAAAGGAGAAATTAAAAATATACGAGATTTTGAAAGAAAAAATGAAGAAAGAACCTATTTACGGAAAAGAGCAGAAAATTACTAATACAAGAGAATGGTCATCAAAAGTTCGATGCTATAGCTGTGGAGAGAAGAGTCATAAAAGTGAAGATTGCCCGAAAAAGATGCAAGGAAAAAAGTGTTTCAACTGCAACGTGTTCGGCCATATTTCTTCACAATGTCCGGCAAAGGCGGAAGCGTCATCGACTACGGCTAGCAGCGCGAGAACGGAGCAGCAACCGAAACGCACATATATCGCTACGACGCAGGAGGGCGCGAACACAATTTTCGAAAATCAATCTGACGAAGTTCACAACGCTATGAATGCTGTGATTGGCTCTGCGAACAGTACGGTGCGCGACAAATGTCATAACAGTAAATTGTTTTCCATGTTCCTTTTGATGGAAGAAGAAAGACACAATTTCATTGACAGTAGAGAAGAACTTAGGAAGGAAGCGAAGAAACAAATATTTACAGTACAAGAAGAAAATAGAAGAAATTACAACAAGAAAATGAAAGAATATACTATATACAAGGAAGGCGACTTAGTAGCTGTGAAAAGGACTCAGTTTGGTACAGGAATGAAACTGAAACCAAAGTTTTTGGGACCATATCGAATAGTAAAGGTCAAAAGAAAGAATAGATACAATGTTGAGAAGGCTGACGCACAAGTTGAAGGCCCTAACAAGACTACTACATCTGCTGATTTTATGAAAAAGTGGCCTGATTACTTAAGTGACTGA
Protein
MARRRSKSQSFDDDDSIFDRPTRGGMFHLTENIIRKFDGKDKTYAVTKWIQDIEENGDIFEWTPKQRLLVARRSLTGTAALWLNSEKTFPCWDTLKIAISKEFPDTIDAKTIHEMMSAKKKKSNESCIDYMFAMKELGRRGKMADYVAIKYVVDGIQDQEINKIMLYGVTTYAELKEKLKIYEILKEKMKKEPIYGKEQKITNTREWSSKVRCYSCGEKSHKSEDCPKKMQGKKCFNCNVFGHISSQCPAKAEASSTTASSARTEQQPKRTYIATTQEGANTIFENQSDEVHNAMNAVIGSANSTVRDKCHNSKLFSMFLLMEEERHNFIDSREELRKEAKKQIFTVQEENRRNYNKKMKEYTIYKEGDLVAVKRTQFGTGMKLKPKFLGPYRIVKVKRKNRYNVEKADAQVEGPNKTTTSADFMKKWPDYLSD

Summary

Uniprot
ProteinModelPortal
PDB
2CQF     E-value=0.000472942,     Score=103

Ontologies

Topology

Length:
434
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0036
Exp number, first 60 AAs:
0
Total prob of N-in:
0.04524
outside
1  -  434
 
 

Population Genetic Test Statistics

Pi
144.579303
Theta
152.903137
Tajima's D
2.149091
CLR
0
CSRT
0.901904904754762
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号