SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03522  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA006246
Annotation
PREDICTED:_NADP-dependent_malic_enzyme_[Bombyx_mori]
Full name
Malic enzyme      
Location in the cell
Mitochondrial   Reliability : 1.299
 

Sequence

CDS
ATGGAGGCCTGTGTACAGAGATACGGACAGAACACTCTGCTCCAATTTGAGGATTTCGCCCTTCCGAATGCCGGTCGGCTCCTGAAGAAATACCGCAATAAATACTGCACGTTCAACGACGACATCCAAGGTACGGCCAGCGTTGCCGTCGCCGGTCTGATGGCGGCCGTCAGGGTCACGAGGAGGAAGCTCAGTGAGAACATTTACCTTTTCCTCGGTGCTGGATCTGCAGCGAACGGCATCGCGAACTTGACTGTGGCCGCCATGATGGCGGACGGACTCTCCGAGAGGCAGGCCCGCGAGAGAGTGTACATGTTCGACGTCGACGGACTATTGTCCACTCGACGTGAAGGAGGGGTTCCGGAGCACGCCAAGGCCTTCGGGAAGGATATCGAACCGGAGAAAGACTTCGAGGCCTGCGTTGCCAAGATCAAGCCTAGCTGTCTTATTGGTTGTTCAACGGTGGGCGGCGCTTTCACGCCCAATGTATTGAAGCAAATGGCGATGAACACCGAGCGACCCGTCATATTCGCACTCTCGAATCCGACCAGTAAAGCTGAGTGCACAGCCCAAGACGCCTACGACCATACGGAAGGTCGTTGCATATTCGCGTCCGGCTCCCCGTTCCCGCCGGTGATGTACAGCGGCCGGGAGTACCGCCCGGGACAGGGCAACAACGCCTACATCTTCCCCGGTGTGGCGCTCGGCGTCATCGCCACGGCCACGCATCACATCTCCGAGAATATGTTCCTGACGGCGGCCAGGACTTTGGCGAACTACGTAAGCGAGTCGGATCTATCCATCGGTCGCATTTATCCGTCGCTGGCTGAAGTGAAAGAAGTGTCCGTCGCTATCGCCATCGAAGTCGCTAAGACCGCATACGACGAAGGTCTTGCCTCAGTGTATCCAGAGCCTCGCGATCTACCGAAGCACGTACAAAACCAAATGTACAGCTATTATTACGAATCTGCAATGCCGGTGACCTGGGATTGGAAGCCCGAGGAGAAGTTCAACGTTAGACCCATCCAACCTGTACCGAAGAACATTTAA
Protein
MEACVQRYGQNTLLQFEDFALPNAGRLLKKYRNKYCTFNDDIQGTASVAVAGLMAAVRVTRRKLSENIYLFLGAGSAANGIANLTVAAMMADGLSERQARERVYMFDVDGLLSTRREGGVPEHAKAFGKDIEPEKDFEACVAKIKPSCLIGCSTVGGAFTPNVLKQMAMNTERPVIFALSNPTSKAECTAQDAYDHTEGRCIFASGSPFPPVMYSGREYRPGQGNNAYIFPGVALGVIATATHHISENMFLTAARTLANYVSESDLSIGRIYPSLAEVKEVSVAIAIEVAKTAYDEGLASVYPEPRDLPKHVQNQMYSYYYESAMPVTWDWKPEEKFNVRPIQPVPKNI

Summary

Similarity
Belongs to the malic enzymes family.
EMBL
BABH01034014    BABH01034015    BABH01034016    BABH01034017    KQ461181    KPJ07636.1    + More
AGBW02009653    OWR50228.1    ODYU01001426    SOQ37596.1    NWSH01001337    PCG71618.1    KQ459249    KPJ02430.1    KZ149899    PZC78631.1    KPJ07637.1    KPJ02429.1    JXUM01021496    JXUM01021497    JXUM01021498    KQ560602    KXJ81680.1    JXUM01100888    JXUM01100889    KQ564606    KXJ72035.1    GAPW01000494    JAC13104.1    CH477207    EAT47850.1    GDHF01000971    JAI51343.1    DS232039    EDS32800.1    GGFK01004902    MBW38223.1    ADMH02000944    ETN64604.1    GGFK01004916    MBW38237.1    GGFJ01003263    MBW52404.1    GEDC01027794    JAS09504.1    GGFJ01003314    MBW52455.1    APCN01002552    GFDL01007813    JAV27232.1    GDHF01001483    JAI50831.1    GDHF01027238    JAI25076.1    GGFM01002542    MBW23293.1    AXCN02001157    GGFM01002520    MBW23271.1    GAMC01019021    JAB87534.1    GAMC01019022    JAB87533.1    AXCM01000270    GBXI01013791    JAD00501.1    GBXI01006333    JAD07959.1    AAAB01008880    EAA08510.5    EGK97005.1    KA646942    AFP61571.1    KA646941    AFP61570.1    SOQ37595.1    GEDC01012664    JAS24634.1    GECU01008999    JAS98707.1    GECZ01017897    JAS51872.1    GFTR01006845    JAW09581.1    GDKW01003589    JAI53006.1    GBBI01002297    JAC16415.1    GANO01001567    JAB58304.1    JRES01001160    KNC25050.1    GBYB01009772    JAG79539.1    KB632397    ERL94598.1    CH954182    EDV53454.1    ACPB03014452    CM000160    KRK04335.1    GECL01000725    JAP05399.1    CH902623    KPU72841.1    EDW98538.1    AE014297    ACZ95043.1    ACZ95044.1    EDV30422.1    CP012526    ALC46036.1    CH480828    EDW45208.1    GAKP01020653    JAC38299.1    AY051465    AAF56674.1    AAK92889.1    CCAG010001986    CH940650    KRF83517.1    CH933806    KRG01135.1    EDW14656.1    GDAI01000138    JAI17465.1    EDW67844.1    KQ971310    EEZ99125.1    CH916374    EDV91599.1    OUUW01000005    SPP80577.1    SPP80578.1    SPP80579.1    LBMM01005231    KMQ91684.1    NEVH01020327    PNF21946.1    JR036673    AEY57309.1    JR036672    AEY57308.1    KZ150227    PZC72042.1    GBHO01011634    GBHO01009599    GDHC01004108    JAG31970.1    JAG34005.1    JAQ14521.1    KQ976870    KYN07694.1    CH964232    KRF99390.1   
Pfam
PF03949   Malic_M        + More
PF00390   malic
PF00431   CUB
Interpro
IPR037062   Malic_N_dom_sf        + More
IPR001891   Malic_OxRdtase       
IPR012302   Malic_NAD-bd       
IPR015884   Malic_enzyme_CS       
IPR012301   Malic_N_dom       
IPR036291   NAD(P)-bd_dom_sf       
IPR035914   Sperma_CUB_dom_sf       
IPR000859   CUB_dom       
SUPFAM
SSF51735   SSF51735        + More
SSF49854   SSF49854       
Gene 3D
PDB
1O0S     E-value=1.40776e-100,     Score=935

Ontologies

Topology

Length:
349
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
24.22431
Exp number, first 60 AAs:
0.70531
Total prob of N-in:
0.94437
inside
1  -  67
TMhelix
68  -  90
outside
91  -  349
 
 

Population Genetic Test Statistics

Pi
199.659644
Theta
175.473868
Tajima's D
1.19624
CLR
0.909081
CSRT
0.710114494275286
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
28467696 AFGINSIVVDGHDVTEIVK 100.00 2e-06
26822097 DIEPEKDFEACVAK 100.00 5e-06
28467696 CIEYQEQIVYPCEK 100.00 5e-06
28467696 AECTAEEAYSNTDDR 100.00 9e-05
26822097 IIGIGDIGAYGMGIPVGK 100.00 0.001
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号