SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03491
Pre Gene Modal
BGIBMGA006348
Annotation
Robo1a_[Bombyx_mori]
Location in the cell
Extracellular   Reliability : 1.744 Nuclear   Reliability : 1.388 PlasmaMembrane   Reliability : 1.057
 

Sequence

CDS
ATGATGGATGCTGGTGTTAATGAGTGCGATAACGCGGCAAATGGAAGGAACCAATTCGTGTTTCTTGTGCTTGTGCATTTACTACTTATCGGACTAAATGGGACTAATGCACAGAATAGAGCACCTCGCATCAAAGAGCATCCGTCGAATACTGTGTCAGGACGCAGTGAACCGGCAACATTGAGATGTGTCGTGGAAGGCCGACCTAAACCTTATGTACAGTGGTTCAAAGACGGATTACCCTTGCCTCAAGCAGAAGACGGACACAGGGTCTTACTCGAAGACGGGCTGTTATTCTTGAGGGTCAACCGAGGGAAGAAAGATAGCGATGAGGGTATTTATTGGTGTGTTGCACGCAACATTGCCGGTGAGGCCGTCAGCCAGAATGCTTCGCTTAATGTGGCTATGCTAAGAGATGAATTCCGAATGGAGCCTAGGGATGTGCAAGTGGCCGCTGGTGAGCCAGCACTATTAGAGTGTTCTCCTCCAAGAGGAGTACCAGAACCATCTGTGCAATGGCTTAAAGACGGACAATCCTACGATGTAGAAGTTAATGGAAGAGTCACAATAACAGATACAGGAAACCTTAAAATTTTAGAAACACTACCCACTGATAGTGGTTTATTTCGATGCGTGGCGACAAATATAGCCGGCGAACGACAGTCAAGAGCCGCTGCTTTAATTGTTTTAAGACGACCACATTTCGTTGTTAAACCTAGTAATGTTACTGCTTTAGTGGGTCAAACTGTCGAATTTAACTGCCAGAGTTACGACTCGAACGTAAAAATAACTTGGGTCAAGGAAGATGGAACGCTGCCGTCTCATGCAACAATAATTCGTGGACTACTAAAATTAGAGCACGTATCTGCAACTGATGCTGGCGTCTATTCATGTCGTGCAGACAGCCACGCGGGAACCAGTATCACCAGTGCCACACTCACGGTTTATTCATTACCGCATTTCACGCAGATACCGTCCAACCTAACAGCTTGGGAAGGCGATGTTGTATCTATTCCATGCGATGCCAAAGGATTACCAACGCCGACGACGTTTTGGATATTAGAAGGCAAACAAGATTCGATGCTTTTTCCGGAATGTACTAGAAGCAATACGAGTTTGTTGTATTTGGACAGTGCGCGGGCGGAGCAAAGTGGAAGGGTAATTTGTACTGCAGTTAACGCAGCTGGAAGTATCATGCAAGAAGCGTATCTTACCGTTCTTAGAAAAGGAAATAGCGAGTTAAGAGACCATACGGATGATGACTTCGAAGATGATTTAGATCGCAATGTTCATATGACCGAGTATGAACTTCTTCAAGCGAGAAAATATCTCCAGCAAAACGTATTAGTGTTGAAGCGAATTGAAATGCTATCATCTTCAAGTGTTAAAGTTGTTTGGGATGTGCTAACAGACTATAATGAATATTTAGAAGGGGTTAAAATATGGTACAATGGGACAACGTTAAATTGGCGAAATATCACAGAAGAAGATTTAACTCAACAAAATTCACATTCAAACACTATTCTGTGCTTAAATGGATCTCTCACCAATGTTGACAACAGTGGTTCATCAAGCTATATACTGTCAGGATTGATGACTTACACGCAATATGATATATTTTTGATGCCATTTTATAAGACCCTTCTAGGGAAGCCTTCCAACATGATGAGTGGGTTTACGGATGAGGGTGTACCGTCGGCACCACCCCAAAGCGTCACAGCAGGGGTGATAAACGCAACATCGGCGTGGATACGGTGGGAGCCACCACCTGTGAGGACTTGGAACGGCGAACTTACCGGTTATTTGATAGAGATACGCGTGAGTGGCAGCACAGGTGGTCGGGTTGTGGGTCAGATGTCATTGAACTCCCGCACCCGCGCCGCAGCCGCGAGCTCCCTCCGCGCGGGTGGCCGCTACACCGCGCGGGCGGCCGCCGTCACGCGTCGCGGACACGGCCCATTCAGTGCACCGGCGCTGATACACATGCTGCCAACTCAGTCGCAGAGGCATTACGTACAGACTGAACCACCAAAAGATTCAAATATACCGAACATACTACAAGAGACTTGGCTCTTGGCTCTCGGGCTCACCCTTTTCTCTGTCATCATCATTGGAGCCGTCAGCATTTACTACATCAAACGGAGAAACAACATACAAAGAAAAAAGTCTGCCGGTCAATCGATTGTCACGGCTCAACAATGTCTCCTAAATAAAGACACGGTTTGGCTTCGCGACAGGCCCGTATTCGGACCGCCTAACGACACGAGCATCGACGTCAACAGCTGTCACCAGAGTCTTTTACATAATGGACAAACCACAAGTATTCTGAACGTGGAACCAGAGTATAGCTTACCGCAGAACTCCATTCAAGGACTAGACGCATCAAGCGTCGACCGTATCAGACGCGGACCACCGGAGCCATACGCGTCAAGCGCCATTTACACAGAACTCAATTTTAAGGACAACAACGAAATCGGAGACCTGAGAGGCTGTCCGGACAGACGATCTCATAACAATAGCATTGTAAGATCGTGTAATGGAAGCATACAATATTCAAATGGCGAATGCTCGACTTGTTGTCACAGTACTTCGAGTAGATCGACCAAAGACTACAGAGAGCTAAGACACGACAATGTACAGAATGAAATTAATGTCTTGGAGGACGACTGCGGTTCTTGCCACACGAACAGATCTGGATCGAGGAGTAGACAGGACAAAAGCAAAGTTTGTCCGGCCGCTGATTTAGATTACGACTATCCCCAATGGCATTGGCTGGGACGGGAGAACAGCTTCAAAATTCCCATCCAAACGAGCAGACATTCGAACATCGCGAGGTCGGAGCAGGGCTGTCAAATAAATCTATGTGATATACTGCCGCCGCCGCCGTATGAGAGTCCAGAAAACAGGCACAACTATGGATCGGAAAAGAATTAG
Protein
MMDAGVNECDNAANGRNQFVFLVLVHLLLIGLNGTNAQNRAPRIKEHPSNTVSGRSEPATLRCVVEGRPKPYVQWFKDGLPLPQAEDGHRVLLEDGLLFLRVNRGKKDSDEGIYWCVARNIAGEAVSQNASLNVAMLRDEFRMEPRDVQVAAGEPALLECSPPRGVPEPSVQWLKDGQSYDVEVNGRVTITDTGNLKILETLPTDSGLFRCVATNIAGERQSRAAALIVLRRPHFVVKPSNVTALVGQTVEFNCQSYDSNVKITWVKEDGTLPSHATIIRGLLKLEHVSATDAGVYSCRADSHAGTSITSATLTVYSLPHFTQIPSNLTAWEGDVVSIPCDAKGLPTPTTFWILEGKQDSMLFPECTRSNTSLLYLDSARAEQSGRVICTAVNAAGSIMQEAYLTVLRKGNSELRDHTDDDFEDDLDRNVHMTEYELLQARKYLQQNVLVLKRIEMLSSSSVKVVWDVLTDYNEYLEGVKIWYNGTTLNWRNITEEDLTQQNSHSNTILCLNGSLTNVDNSGSSSYILSGLMTYTQYDIFLMPFYKTLLGKPSNMMSGFTDEGVPSAPPQSVTAGVINATSAWIRWEPPPVRTWNGELTGYLIEIRVSGSTGGRVVGQMSLNSRTRAAAASSLRAGGRYTARAAAVTRRGHGPFSAPALIHMLPTQSQRHYVQTEPPKDSNIPNILQETWLLALGLTLFSVIIIGAVSIYYIKRRNNIQRKKSAGQSIVTAQQCLLNKDTVWLRDRPVFGPPNDTSIDVNSCHQSLLHNGQTTSILNVEPEYSLPQNSIQGLDASSVDRIRRGPPEPYASSAIYTELNFKDNNEIGDLRGCPDRRSHNNSIVRSCNGSIQYSNGECSTCCHSTSSRSTKDYRELRHDNVQNEINVLEDDCGSCHTNRSGSRSRQDKSKVCPAADLDYDYPQWHWLGRENSFKIPIQTSRHSNIARSEQGCQINLCDILPPPPYESPENRHNYGSEKN

Summary

Pfam
PF07679   I-set        + More
PF00041   fn3
PF00853   Runt
Interpro
IPR013783   Ig-like_fold        + More
IPR007110   Ig-like_dom       
IPR003599   Ig_sub       
IPR003961   FN3_dom       
IPR036116   FN3_sf       
IPR013098   Ig_I-set       
IPR036179   Ig-like_dom_sf       
IPR003598   Ig_sub2       
IPR008967   p53-like_TF_DNA-bd       
IPR013524   Runt_dom       
IPR012346   p53/RUNT-type_TF_DNA-bd_sf       
IPR000040   AML1_Runt       
SUPFAM
SSF48726   SSF48726        + More
SSF49265   SSF49265       
SSF49417   SSF49417       
Gene 3D
PDB
5OPE     E-value=2.16676e-80,     Score=765

Ontologies

Topology

SignalP
Position:   1 - 37,         Likelihood:  0.536555
 
 
Length:
977
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
37.89648
Exp number, first 60 AAs:
14.96622
Total prob of N-in:
0.76003
POSSIBLE N-term signal
sequence
outside
1  -  689
TMhelix
690  -  712
inside
713  -  977
 
 

Population Genetic Test Statistics

Pi
244.289437
Theta
174.945345
Tajima's D
1.144796
CLR
0.001409
CSRT
0.700514974251287
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号