SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03490
Pre Gene Modal
BGIBMGA006532
Annotation
PREDICTED:_immunoglobulin_superfamily_DCC_subclass_member_3-like_isoform_X1_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.146
 

Sequence

CDS
ATGATCGCCGGTTCGAATAAGAATAAACAAATATGCAATCAAGTGAAATTTATTGTACTGTTGTATTTTTTATTGAATTTACCTTGTACCGCGAGATCTCAAAGCCGGGCTCCGCGTATAAAAGAACATCCAGCCGACACAATAGTCGGTAGAAGCGAGCCTGCTACTCTGCGGTGTGTATCCGAAGGAAAGCCCAAACCGACAATACAGTGGTATAAAGATGGCACGCCTCTTACTTCTAATGACCACCCACAAAGAGTGCTGCTTGAAGACGGATTACTCTTCCTTAGGGTTATGCGAGGCAAGAAGGAAAGCGACGAGGGCGTCTACTGGTGCGTCGCACGCAACCCCGTCGGGGAAGCAGTTAGCAAAAACGCCACGCTTACTATTGCCGTACTCCGCGATGAATTTAAGATCGAACCTCACGATGTAAAAGTAGCTAGTGGCGAACCTGCTCTTTTACAATGCGCATCACCGAAAGGGGTGCCTGATCCGTCTATACATTGGAATAAAGATGGGCATAGTTTAGACGTAGAAATCAATGGAAGAATATCAGTAGTGAATGGAGGTGATTTAAAAATACTGGAAACAATACCATCGGACAGTGGTGTTTATAGATGTGTAGCGTCTAATGTGGCAGGCGAAAGGCAATCTCATCCTGCTACGCTTCTCGTCTTACGCAGACCGCATTTTCTGGTGAAACCGAATAACATAACGGCTTTAATAGGCCAGAACATTGAGTTTCACTGTCAAGCATCACCAGAATCCGATGTATCAGTAAGTTGGGCACGAGACAGTGGTTCGTTGTCTCCGTACGCGATAATTCGAAGAGGTTCGCTAAGAATAGATCGCGTTGTTGCTACCGATGCGGGGACATACACTTGCAGAGCCGAAAGCCAAGCAGGCTCTAGTTCTGCGAGTGCATCTTTAACTGTAAACTCTTTACCGCATTTTACACGAGTACCTTCAGACACAACAGCGTGGGAGGGAGAAGCGGTATCATTCCCTTGTGAAGCAGATGGTTCCCCGAGACCAGTCGTCTTTTGGACAATGGAAGGGTCTCAAGAATTAGTTTTTACGAAATCAACGCACAGCTCCGGATATTTATATTTGGATCGAGTCACAATAAGACATGCAGGAAGACTTACTTGCGTCGCTGTGAATTCTGCTGGGAGCGCTTTGCATACTGCCACTTTGCAGGTATTAAGGAGAGAAGCTAATAATTTTAAGGATGATTTAGACTCATCCTCGCCCTATCCTGAATTGAGTAAACCCTTAAATTATCCACCAATGACTCAATATGAATTAGTGCAGGCTCGACGATACTTACAACAGGATGTATTATCTTTGAAACGAGTGGAGGGTATTTCGGCTACGACTTTAAAAATTGTATGGGATGTAATGACAGAGTACAACGAATATCTTGAAGGTGTTAAAATTTGGTTCAACGGGACTTCATTAAACAGCAGAAGTGCCTTGGAACTTGACTATAATTCCAACGAATCGACTATTGATTATATGACAGATTTTAGAAAATATGAAAACTTTACTATGACAACTGTACACAACAGTGGTTCGTCTAGTCATGTACTAACAGGCCTATTACCTTACGCTCAATACGATGTGTTTTTGATGCCGTTCTACAAACTATTATTAGGAAAACCTTCCAACATGCGTACCGGTTTTACAGAGGAAGATGTTCCTTCGGAGCCTCCGCTAAGTGTTACAGCGGGAGTGATAAATGCGACATCAGCTTGGATTAGATGGGAAGCACCTCCTGTTTACGCGTGGAACGGAGAAATCTCCGGATATCTGATCGAAGTTCGCGTTGGTGGATCCACTGGAGGTCGAGTAGTGGGACAGATGTCGCTAGGTCCCAAAACTAGGGCAGCAGCAGCTAGTTCCTTGCGTGCTGGAGGTCGGTACAGCGCAAGAGCTGCAGCCGTTACCAAGCGAGGTCACGGACCTTTCAGCCCGCTATCTCATTTTCACATGGTTCCTACACAAACTCAGAGACATTACGTGCAAACGGAACCAGCCACAGACAAAGCAATAATATCGATGTTCCAAGAAACCTGGCTCTTAGCACTCAGTGTAACATTGTTAGTGTTAATATTTGCTGGAGTTGGTGTTATAGTTTACATTAAGAAACGTCATTCTAAACAACAAAAAAATCAGAGCTCAACCGGAAATACAGTAGTTAATGCTCAACAATGTCTCCTGAGGAAAGAAGCTGTTTGGTTAAGAGAAAGATCAGTTTTTGAAGGATCAACGGAACCGAGAATCGAAATTTTAAACTGTCATCAGACTCTTTTAAAAAGCGGTCACTCCGTAGGTACAATGGCTACGGAAGCTGAATATAGTCTTCCTCAACATTCGAACACAGTAAATCCAAAGTGCGAAGAAGAACAACAAAGACTCCAACCACAGCCATACGCATCTTGTGCCATTTACACAGAACTAAATTATCAAGATAACACAGACGCGGAAGATTCTTGTATGAAGTGCGCCATTAGCCCAGGTTCCTATGACAATAGTATGATTAGGTCTTATGGAGAAAGTAATCAATATTCAAATGAAGAGTGCTCTACATGCTGCAGGAGTAGTAGTTCCACTTTAACAAAAGATTATAGTGACATGACAAAATGCAATGAAGACCAAGATATGTCAATAGAAGACTGTCCTTCGTGCAAAACTAATCACTCGAGATCATCTAGTCATCACGGAGGCAACAAAGAGTGGACCACGGCGGATGTTGAATACGATTATCCCCAATGGAATTGGTTGGGCCGAGACAACAGTTTCAGGAATACAAACTCAGAGCCTAGGTATAATGGAGAAAATTGTTTTAGGCAAATAGGTCAAGAACTTAGATACAATAGTGCGGATAGAAGTGAACAAAATTGTAGAATGAATTTATGCGATATATTGCCTCCGCCGCCCTATGAAAGGGAGTCTCCATATAGAGATATGAATGCATTTACAAATCACTCAGGGACATCGGGTTGTTCCGGACATACGTACCGAAGCTAA
Protein
MIAGSNKNKQICNQVKFIVLLYFLLNLPCTARSQSRAPRIKEHPADTIVGRSEPATLRCVSEGKPKPTIQWYKDGTPLTSNDHPQRVLLEDGLLFLRVMRGKKESDEGVYWCVARNPVGEAVSKNATLTIAVLRDEFKIEPHDVKVASGEPALLQCASPKGVPDPSIHWNKDGHSLDVEINGRISVVNGGDLKILETIPSDSGVYRCVASNVAGERQSHPATLLVLRRPHFLVKPNNITALIGQNIEFHCQASPESDVSVSWARDSGSLSPYAIIRRGSLRIDRVVATDAGTYTCRAESQAGSSSASASLTVNSLPHFTRVPSDTTAWEGEAVSFPCEADGSPRPVVFWTMEGSQELVFTKSTHSSGYLYLDRVTIRHAGRLTCVAVNSAGSALHTATLQVLRREANNFKDDLDSSSPYPELSKPLNYPPMTQYELVQARRYLQQDVLSLKRVEGISATTLKIVWDVMTEYNEYLEGVKIWFNGTSLNSRSALELDYNSNESTIDYMTDFRKYENFTMTTVHNSGSSSHVLTGLLPYAQYDVFLMPFYKLLLGKPSNMRTGFTEEDVPSEPPLSVTAGVINATSAWIRWEAPPVYAWNGEISGYLIEVRVGGSTGGRVVGQMSLGPKTRAAAASSLRAGGRYSARAAAVTKRGHGPFSPLSHFHMVPTQTQRHYVQTEPATDKAIISMFQETWLLALSVTLLVLIFAGVGVIVYIKKRHSKQQKNQSSTGNTVVNAQQCLLRKEAVWLRERSVFEGSTEPRIEILNCHQTLLKSGHSVGTMATEAEYSLPQHSNTVNPKCEEEQQRLQPQPYASCAIYTELNYQDNTDAEDSCMKCAISPGSYDNSMIRSYGESNQYSNEECSTCCRSSSSTLTKDYSDMTKCNEDQDMSIEDCPSCKTNHSRSSSHHGGNKEWTTADVEYDYPQWNWLGRDNSFRNTNSEPRYNGENCFRQIGQELRYNSADRSEQNCRMNLCDILPPPPYERESPYRDMNAFTNHSGTSGCSGHTYRS

Summary

Pfam
PF07679   I-set        + More
PF00041   fn3
PF00853   Runt
Interpro
IPR003599   Ig_sub        + More
IPR007110   Ig-like_dom       
IPR003961   FN3_dom       
IPR013783   Ig-like_fold       
IPR013098   Ig_I-set       
IPR036116   FN3_sf       
IPR003598   Ig_sub2       
IPR036179   Ig-like_dom_sf       
IPR008967   p53-like_TF_DNA-bd       
IPR013524   Runt_dom       
IPR012346   p53/RUNT-type_TF_DNA-bd_sf       
IPR000040   AML1_Runt       
SUPFAM
SSF48726   SSF48726        + More
SSF49265   SSF49265       
SSF49417   SSF49417       
Gene 3D
PDB
5O5G     E-value=2.28786e-80,     Score=765

Ontologies

Topology

SignalP
Position:   1 - 31,         Likelihood:  0.762523
 
 
Length:
1010
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
25.32448
Exp number, first 60 AAs:
2.34841
Total prob of N-in:
0.12225
outside
1  -  692
TMhelix
693  -  715
inside
716  -  1010
 
 

Population Genetic Test Statistics

Pi
306.034916
Theta
210.259972
Tajima's D
1.238534
CLR
0
CSRT
0.72096395180241
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号