SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03482
Annotation
PREDICTED:_uncharacterized_protein_LOC106708887_[Papilio_machaon]
Location in the cell
Nuclear   Reliability : 1.651 PlasmaMembrane   Reliability : 1.446
 

Sequence

CDS
ATGTCGGTGTCCTACATTCGCGGGAAGGTGACTAGTGAGCTCCGATGGTTCGCATCAGCTCATGCTTTGGTTGACAGAACAGATAGGGATGCGGCATTGCTCGATAGGGCGTCTCAGGTGCACGAACGGTTGGAGGTAGTGTACGATCGGTTGTCTGACCTCGTTGCTTTGGGGTCCGAAGTGGAGAAGGAGGTGATCCATGCCATCGGTCTTGACGTGGACCAGTGTCAGGAGTACGCTGATGCCATTCTGCAACGGGTGGCCGATATTAAGAAGCAGTCGTCATCCGGTGGTAATGGAGGTTCGGGAACTTCGTCAGGCGTCATATCACGCCTCCCCTCCATCGACCTGCCGATCTTCCACGGTGATCTGAACGAGTGGGTCGGCTTTATAAATTTGTTTGACAGCCTGGTCCATGGTCGGTCGGACTTGACTGCCTCTTATAAGATGGCTCAGCTTCGGGGTGCTCTGCGAGGTGAACCTGGTGAATTGGTGGCACACTTGCCTATCACCAACGACAATTATGCGGTCGCACGCCAGATCCTGTTCGACCGATATCAAAATCAACGACGGTTGGTAGACACTCAGCTGGCCAGGCTGTTTGCGATACCCAAACTTTCTCGGGCTTCCGATATCAGAGCCGAGGTACTGAATCCAGTTACGGTGGCCACTAAGGCCTTGGGAAATTTGGGTCTACCAGTAGACCAATGGTCATATCTGCTCTTTTATATTGTTGCAGGTAGGCTGCCGGTTGAGGTGCTCACTCGATTCGAGCAGCAGGACAACGCAGGTAGGGACGAACTGCCTACCCTGGCCAGTCTGCTGGCATTTTTAGAAGCTGAAAGTCGCCGACACGAGATTATGCCACCGCCCTCCTCCTCTGGGTCGCGTGTGCCGGCTTCCGGCCACGCCGTTTCGGTTGCTCAGAGGGGAGGGGGAGGGGATAAGAGGGGGCCGTCTCAACGACTGACTGCGCTCATGGCAGCGGTGGGAGGCCCACGGTGTGCCTTCTGTCATGAGAGCGGGCACGACGTAGCCGCCTGTCCGAGGTTCCGGTCGACGCGCATCAGGGGTAGACGCAACATCGTTGCCCAGCGGCGATGGTGCTTTTTTTGTTTTGGGCCGCACACGGCGAGCGTCTGTCCACAGCCACAATTGTGCCCTAATTGCGACGGTCGGCACCATGCCCTCCTGTGTCTGGAGTCTGCCGCCACTCCGAGGTCATCCGGACGCAGTCATCCAGCCTCGCCGACCGGTGAGCGCACCGGTCGTAGCCCTCGCCAATTCGGCGGCGTGGACCCTCGGAAAGAGGCTTCGCAGGGAGGCGCCGGGTTAGGTACTGCGGGCGGGTGCCAGCGGATGCCCATTAGCTACGCCGGGGTGGCCACGTTGTCCCCCCGTGCGGGGCCGTGTTCGCCTGCTGGATCGAGTAGCCCTGCTCACTCGTCTCCCCCTCCCTCAGAAGTACGGTTTTCTCCTCCGCTGAGGGAGCGGCCGACGCTGGAGCGACTCCCTCCAGTGTTTGGACCGTTTGGCCATCGTACGCGGAGTGTTGCCCCAGCCCCAGAAGCTGTTTTACTTCCTACCGCTTCTGTTCGGGTGTTGGATTCGGATGGCAACACTGTGTTTGCTCGAGCTCTGTTGGATTCCGGCGCACAGGGCAGTATTATGTTGAGCAACCTTGCAGTACGGTTGGGCAATCCTATTTACAAGTCTTCTTATTCTATTCGTGGAGTGGGCAATGTTAGAATTTCGGACGTGATCGGTCACACTTCATTTATTTTCTCATCGAATCCCAACCCTCGCTTACAGTTTAGAGTCTCAGCTTTGGTGATGCCTCAGGTGATAGGTCGTCACCCTCCGGTGAAGGTAAACAGTTACATACGGTCATTGACTTCAGACTTACGGCTAGCGGACCCCAAGTTTGACACACCGGGGCCAGTAGACGTACTACTTGGGGCGGATGTACTAGGGAAGCTGCTCCTGACTGGGAAGCGCGTTCTTCATGCGGAGGGTTTGGTTGCAATGGACACAAAATTAGGGCATGTATTGTTGGGTCCTGCGTTCCGGCCAGTCGCTGCGAGGAAATCGGACAATTTTCTGGTCGGGTCTACGCTTTCGGAAGTAGTCCAACGGTTTTGGGAACTAGAAGAACCTCCTACAGCTTATCGAGTTAACCCGGATGAGGAGGAATGTGAGCTGTTTTACCAGAATAATACGGGTCGTCTCTATTCGGGCCGGTTCTTGTTAAGACTTCCTTTTCGGGCGAATCGCCCACTGCTAGGCAGTTCGAGGAAGGCAGCAGAGACCAGACTTTTGTCAATGGAGAGACGCATGAGGCGCGACGCGGTGTTCCGGCAGAAATATGTAGAGTTTATGCGGGAGTATGAATCTTTAGGTCACATGTCGGTTTCCAAGGTAGATTGGAGTGCTACGGAGCACTGTTTCCTGCCTCATCATGCGGTTTTGAAAACTCCTAACGGTAAAATTAGGGTCGTGTTTGACGGTTCGGTCACGACCTCCTCCGGCGTCTCGTTAAATCAGTGTCTCCATTCGGGTCCAAAGCTGAACCGGGACATTTCAGACATACTGACGAGCTTCCGCAGGCACCAGATCGTTTTCGTGGCAGACATCCGTATGATGTTCAGGCAAACGGTGATTCATCCGGAGGATAGGCGGTATCAACTCATTCTCTGGCGTGAAAGCTCAGATGAGCCCATAAAAATTTATGAACTGAACACGAACACTTACGGGTTGCGGTCGAGTCCATATTTAGCGGTTCGTTCTTTGCGGGAGTTGGCAGTGAGGGAACGGTTGCACTACCCTCGTGCTGCGGACATTTTGGAACGGGACCTATATGTCGATGACGTATGTACGGGCGCCGACAGTGTCGAAGAGGCCTTATCACGCAAGGATGAACTGATCCGCCTTTTAAGCAGGGGCGGGTACGAGTTGAGAAAATGGCTGTCTAACTGTCCTGAGTTGTTGACTGGTTTGCCAACGGAGTTTCAACAGGACCCCCATCTTTTCGAGAATGTCGATAACCCTAACATGCTGTCGGTCCTAGGGATTCAATATCGTCCGATTCAAGACGAATTTACCTATCGGGTGGAGTTGGAAAATCCAAAGGTATGGTCTAAGCGAACGGTGCTTTCCACAATTGCTCGAACCTTCGATCCAAACGGTTGGATCGCTCCTGTCACTTTTCTCTTAAAGTGCTTCATGCAGCGACTGTGGTCTGCTAACCTGTCATGGGACGAGGGGATTGCTGGTGACCTATTGAAGGATTGGTTGAACTTTTTCTCGTCTCTCCCTGATATTAACCACGTGTCAATACCTCGGAAGCTGGTTCCTGCGGGCAAATACAAGGCGTCTCTCCACGGGTTTTCGGATGCCTCGGAACGCGGATTCGCAGCTGCGGTATACTTGCGAACGGTTTCTTCAACTGGAAGGGTTGATATACGGTTGGTGTTAGCTAAGAGTAAGGTCGCTCCGCTTCGGACACGCATGACGATTCCGAAGCTCGAGTTGTCTGGTGCCGCTCTGTTGACTAGGTTGTTAAACCATACAGCTACTAGTTTACGGTCGGTTATTGATTTAGAAAACACTGTCTATGCTTGGACAGACAGCCAGATAGTGTTGTGCTGGTTGAAGGCTTCGGTTCATACACTTGAAGTTTTCGTGGCCAACCGTGTCTCCCAGATTCAAGGTTCTGAGGTCCCTCTAACATGGAGACACGTGCCTGGTGAGCTCAATCCGGCGGACTGCGCTTCTCGGGGATGCTTAGCATCGGAAATAGTTGATCATCAGTTATGGTGGGGTCCCCAGTGGCTCACCAAGAAAGCTTCTCAGTGGCCTCCCTCTCGCATAGAAGTTCCTCCAGGTCTCGTGGCTGCACCGGCGCAGTTCGAGGATCGAGGAGTAATTCAGGGGTTGGATTTGGATCTGCTCATCAACCGTTATAGCTCCTTGGACAAGCTGGTTAAGGTTACCGCCTGGATTTTGAGGTTTATTCGGAATTGTCGTTTGTCGGTGTCTCAACGCAATATGACACCTGTTGTGTGTCCCATCGAGCGGAAGAAGGCGCTGCTGAAATTAATTGAAGTTGTGCAAGCCACCAGCTTTCATTCAGAATTGAAGGCGCTAAGGACTAAGCGCCCTAAGCTTCGTGGAGCTATCGCTCGTCTTAGCCCCTTTGTAGACGGCCAGGGGCTGATTCGAGTGGGAGGTAGATTAAGTAACTCCAATTTACCTTATTCGGCGCGCCATCCTCTTTTACTTCCCAAGAAGAGCCAGTTAGTTGACCTGTTGGTGATGGATCGCCACATCGCAAATTCGCATTCCGGTTGCAATGCGCTGTTGGCATCCCTCCAGAGGGAATTTTGGATTCTGTCAGGGCGTCGTACGGTTCGGAGCGTCCTTTTCCGGTGTTTACCCTGTTATCGGCTTAAGGCGTCTACGATGCAGCCTCAGATGGGAGATCTGCCTCCAGACAGAGTGAAGAAGATGAGGCCGTTTTCTGGAGTTGGTACGGACTTCGCTGGGCCTTTCATGATCAAGGCTTCACGTTTGCGGAATGTTAGGTTAATTAAGGCTTATCTGTGCGTTTTTGTCTGCCTTTCAACCAAAGCTGTACATCTTGAAGTTGTTGCCGACCTTACAACTGAAGCCTTTATTGCGAGCTTGGATAGATTTGTGTCCCGTCGAGGCTTACCCGAATTGATACGCTCCGATAACGGAACGAATTTTGTAGGTGCGGACCGTTACTTGCGGGATGTAGTAAATTTCTTGAACAATAACCAGGTGGATATTGAAACGGCCCTCTCTCGTCGCGGTATTCGGTGGACCTTCAGTCCTCCAGGATGCCCCCACTGGGGTGGAATTTTCGAGGCAGTAGTAAAATCGGCTAAGACTCACTTGATGCGCGTGATAGGGCAACCCTCGCTCACCTTTGAGGAGTTAACTACGGTATTTTGTAAAATTGAAGCGGTACTTAATTCGCGGCCGTTGTGCCCGCTCAGTTCAGACCCGAATGACTTGGAGTCGTTAACTCCAGGCCATTTCTTGATAGGACAGCCACTCAATGCGTTGCCGGAGTATCCCCTCTCGGATATCAAGCCTGGACGGTTGAGGCGATACCAGATGTTGCAGCAGATGTCCCAAGATTTTTGGAAACGTTGGTCCCTTGAGTATTTACATCTGCTCCAGCAGCGCTTTAAGTGGACGGATAGAACCAGTCCCCCTCACGTCGGTGACCTTGTGTTGGTTAAGGATGCTAACCTGCCGCCACTGCGTTGGCGTAGGGGGCGCATTGTTAATCTGTTTCCCGGTAAGGATGGGACCCCTCGGTCTGCAGAGGTTCTGGTCGGGGACTCGGTTCTCAAACGAGCGGTCACAACGTTGTCCCGGCTGCCAGTTGATTAG
Protein
MSVSYIRGKVTSELRWFASAHALVDRTDRDAALLDRASQVHERLEVVYDRLSDLVALGSEVEKEVIHAIGLDVDQCQEYADAILQRVADIKKQSSSGGNGGSGTSSGVISRLPSIDLPIFHGDLNEWVGFINLFDSLVHGRSDLTASYKMAQLRGALRGEPGELVAHLPITNDNYAVARQILFDRYQNQRRLVDTQLARLFAIPKLSRASDIRAEVLNPVTVATKALGNLGLPVDQWSYLLFYIVAGRLPVEVLTRFEQQDNAGRDELPTLASLLAFLEAESRRHEIMPPPSSSGSRVPASGHAVSVAQRGGGGDKRGPSQRLTALMAAVGGPRCAFCHESGHDVAACPRFRSTRIRGRRNIVAQRRWCFFCFGPHTASVCPQPQLCPNCDGRHHALLCLESAATPRSSGRSHPASPTGERTGRSPRQFGGVDPRKEASQGGAGLGTAGGCQRMPISYAGVATLSPRAGPCSPAGSSSPAHSSPPPSEVRFSPPLRERPTLERLPPVFGPFGHRTRSVAPAPEAVLLPTASVRVLDSDGNTVFARALLDSGAQGSIMLSNLAVRLGNPIYKSSYSIRGVGNVRISDVIGHTSFIFSSNPNPRLQFRVSALVMPQVIGRHPPVKVNSYIRSLTSDLRLADPKFDTPGPVDVLLGADVLGKLLLTGKRVLHAEGLVAMDTKLGHVLLGPAFRPVAARKSDNFLVGSTLSEVVQRFWELEEPPTAYRVNPDEEECELFYQNNTGRLYSGRFLLRLPFRANRPLLGSSRKAAETRLLSMERRMRRDAVFRQKYVEFMREYESLGHMSVSKVDWSATEHCFLPHHAVLKTPNGKIRVVFDGSVTTSSGVSLNQCLHSGPKLNRDISDILTSFRRHQIVFVADIRMMFRQTVIHPEDRRYQLILWRESSDEPIKIYELNTNTYGLRSSPYLAVRSLRELAVRERLHYPRAADILERDLYVDDVCTGADSVEEALSRKDELIRLLSRGGYELRKWLSNCPELLTGLPTEFQQDPHLFENVDNPNMLSVLGIQYRPIQDEFTYRVELENPKVWSKRTVLSTIARTFDPNGWIAPVTFLLKCFMQRLWSANLSWDEGIAGDLLKDWLNFFSSLPDINHVSIPRKLVPAGKYKASLHGFSDASERGFAAAVYLRTVSSTGRVDIRLVLAKSKVAPLRTRMTIPKLELSGAALLTRLLNHTATSLRSVIDLENTVYAWTDSQIVLCWLKASVHTLEVFVANRVSQIQGSEVPLTWRHVPGELNPADCASRGCLASEIVDHQLWWGPQWLTKKASQWPPSRIEVPPGLVAAPAQFEDRGVIQGLDLDLLINRYSSLDKLVKVTAWILRFIRNCRLSVSQRNMTPVVCPIERKKALLKLIEVVQATSFHSELKALRTKRPKLRGAIARLSPFVDGQGLIRVGGRLSNSNLPYSARHPLLLPKKSQLVDLLVMDRHIANSHSGCNALLASLQREFWILSGRRTVRSVLFRCLPCYRLKASTMQPQMGDLPPDRVKKMRPFSGVGTDFAGPFMIKASRLRNVRLIKAYLCVFVCLSTKAVHLEVVADLTTEAFIASLDRFVSRRGLPELIRSDNGTNFVGADRYLRDVVNFLNNNQVDIETALSRRGIRWTFSPPGCPHWGGIFEAVVKSAKTHLMRVIGQPSLTFEELTTVFCKIEAVLNSRPLCPLSSDPNDLESLTPGHFLIGQPLNALPEYPLSDIKPGRLRRYQMLQQMSQDFWKRWSLEYLHLLQQRFKWTDRTSPPHVGDLVLVKDANLPPLRWRRGRIVNLFPGKDGTPRSAEVLVGDSVLKRAVTTLSRLPVD

Summary

EMBL
KK114194    KFM61875.1    ABLF02005684    GEZM01085145    GEZM01085143    JAV60187.1    + More
GEBQ01022991    GEBQ01006185    JAT16986.1    JAT33792.1    GEBQ01007199    GEBQ01000222    JAT32778.1    JAT39755.1    LBMM01009888    KMQ87813.1    GEZM01054765    JAV73413.1    LNIX01000036    OXA39969.1    LNIX01000007    OXA51795.1    ABLF02021785    ABLF02039606    ABLF02054908    LBMM01010405    KMQ87487.1    LNIX01000069    OXA36894.1    LNIX01000016    OXA46198.1    ABLF02030698    ABLF02030705    ABLF02030709    ABLF02006304    ABLF02036268    ABLF02041614    ABLF02030854    ABLF02067347    ABLF02001506    ABLF02008029    ABLF02035899    ABLF02037719    ABLF02046327    ABLF02064627    GGMR01010723    MBY23342.1    LBMM01009964    KMQ87756.1    GGMR01002024    MBY14643.1    LBMM01009202    KMQ88311.1    GGMR01018294    MBY30913.1    LBMM01008464    KMQ88855.1    ABLF02035780    LBMM01009645    KMQ87967.1    ABLF02028666    ABLF02066713    GGMR01016460    MBY29079.1    ABLF02008636    ABLF02065931    LNIX01000002    OXA60848.1    ABLF02025193    GEBQ01015458    JAT24519.1    GEBQ01000825    JAT39152.1    GBHO01044317    GBHO01044315    JAF99286.1    JAF99288.1    GBHO01038805    GBHO01038804    GBHO01038801    JAG04799.1    JAG04800.1    JAG04803.1    GGMR01005823    MBY18442.1    GEZM01060254    JAV71154.1    LBMM01009551    KMQ88039.1    GGMR01002187    MBY14806.1    GBHO01034065    GBHO01034061    JAG09539.1    JAG09543.1    ABLF02008594    LBMM01006490    KMQ90572.1    GGMR01013370    MBY25989.1    ABLF02015138    LBMM01007859    KMQ89359.1    LBMM01009898    KMQ87805.1    GBRD01007977    JAG57844.1    ABLF02004035    ABLF02004036    ABLF02004037    ABLF02004038    ABLF02008018    ABLF02008020    ABLF02012635    ABLF02061171    GGMS01014951    MBY84154.1    LBMM01009746    KMQ87900.1    GGMR01006575    MBY19194.1    GGMS01010524    MBY79727.1    ABLF02022040    ABLF02056888    GGMR01002421    MBY15040.1    OXA59522.1    ABLF02036131    ABLF02041527    ABLF02064049    LBMM01009688    KMQ87939.1    GGMR01017890    MBY30509.1    GGMS01012379    MBY81582.1    GFTR01008866    JAW07560.1    LBMM01010417    KMQ87475.1    ABLF02067195    GEZM01066272    JAV68024.1    GGMR01020500    MBY33119.1    ABLF02041650    GGMR01018506    MBY31125.1    GBHO01007689    JAG35915.1    GGMR01014351    MBY26970.1    GBHO01008418    GBHO01008416    JAG35186.1    JAG35188.1    ABLF02023842    ABLF02028949    ABLF02058391    GGMR01005535    MBY18154.1    GBBI01004479    JAC14233.1    GEZM01021505    JAV88969.1    GFTR01008874    JAW07552.1    QOIP01000009    RLU19024.1    GBHO01044316    JAF99287.1    ABLF02041762    ABLF02041670    LNIX01000005    OXA54454.1    ABLF02006784    GGMR01014306    MBY26925.1    GGMS01006636    MBY75839.1    GBBI01004211    JAC14501.1    GDHC01014057    JAQ04572.1    ABLF02005616    ABLF02059449    ABLF02041863   
Pfam
PF17919   RT_RNaseH_2        + More
PF05585   DUF1758
PF17921   Integrase_H2C2
PF05380   Peptidase_A17
PF18701   DUF5641
PF17917   RT_RNaseH
PF03564   DUF1759
PF00078   RVT_1
PF00665   rve
PF09337   zf-H2C2
Interpro
IPR008737   Peptidase_asp_put        + More
IPR021109   Peptidase_aspartic_dom_sf       
IPR040676   DUF5641       
IPR000477   RT_dom       
IPR005312   DUF1759       
IPR041373   RT_RNaseH       
IPR036397   RNaseH_sf       
IPR041588   Integrase_H2C2       
IPR001969   Aspartic_peptidase_AS       
IPR041577   RT_RNaseH_2       
IPR001584   Integrase_cat-core       
IPR012337   RNaseH-like_sf       
IPR008042   Retrotrans_Pao       
IPR001878   Znf_CCHC       
IPR001995   Peptidase_A2_cat       
IPR015416   Znf_H2C2_histone_UAS-bd       
IPR036875   Znf_CCHC_sf       
IPR000727   T_SNARE_dom       
SUPFAM
SSF50630   SSF50630        + More
SSF53098   SSF53098       
SSF57756   SSF57756       
Gene 3D
PDB
5UOQ     E-value=0.0124723,     Score=97

Ontologies

Topology

Length:
1807
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01621
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00061
outside
1  -  1807
 
 

Population Genetic Test Statistics

Pi
204.758468
Theta
180.67915
Tajima's D
-1.071999
CLR
192.482443
CSRT
0.122893855307235
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号