SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03475  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA006357
Annotation
PREDICTED:_probable_ATP-dependent_RNA_helicase_pitchoune_[Papilio_polytes]
Full name
RNA helicase       + More
Probable ATP-dependent RNA helicase pitchoune      
Location in the cell
Nuclear   Reliability : 3.608
 

Sequence

CDS
ATGCCGACACCAGATAAAATACTTCTCAGAAAAATAAGAAAACGAGAAAAACGAAAACTGAAACTTACATCTCAAAAAACTGATTCAAATCCTGAACCAGAAAAAGATATTGAAGCATTAAATAATGAAAAAGAAGCTAAGAAGAGAGTTGTACAAGACGGTGACACAAATGGAAAAGTTCCCAAAAAAAAATTGAAAAAGGTTAAAGAAGAGTTAAAAGAAGAACCAGTTGAAGTAAAATCTGAGGAAGAATCTAGTGATGACTCTCAAGATGAGCAAGACACTAAAGAAGATGATTCGGAAAAAAAATCGAACAACGATTTACCTGGATCAAGCCTCTGCTTAGGTATACTATCAGATCAAAAATTCACTGCACTGGAAGGCACAGTGTGCGAACCAACTCTTTTAGGAATTAAAGATATGGGCTTTATAACGATGACAGAGATTCAAGCTAAAGCTATACCTCCTTTGTTGGAAGGCAGGGATCTTGTGGGTGCTGCCAAAACTGGCTCTGGAAAAACACTAGCATTCTTAATACCGGCTATAGACCTTATATACAAATTAAAATTTAAACCAAGAAATGGTACTGGAGTCATCATTTTGTCACCCACAAGAGAGTTATCAATGCAAACATTTGGCGTTCTCATGGAATTGATGAAATACCACCACCATACATATGGTCTGGTAATGGGTGGTGCAAACAGAAGTACTGAAGCTCAGAAACTCTCTAAAGGTATCAACATTTTAGTTGCTACTCCTGGACGTTTACTGGATCACTTGCAAAATACACCAGACTTCTTGTATAAGAACCTTCAGTGCTTAGTTATTGATGAGGCTGACAGGATATTGGAAATTGGATTTGAAGAAGAAGTTAAACAGATCATAAAATTGCTGCCAAAACGCCGGCAAACTATGTTATTCAGTGCTACACAAACAAAGAAGACTGAAGCACTAACTGCTTTGGCATTGAAGCATGAACCCGTGTATGTTGGGGTTGATGACCACAGAGAACAGGCAACTGTTGATAGTTTAGAACAGGGATATATCGTATGCCCATCAGAGAAACGTATGATGGTTTTATTCACATTCCTTAAGAAGAATAGAAAAAAGAAGGTTATGGTATTCTTTTCAACCTGTATGTCTGTCAAATACCACCATGAACTTTTCAATTATATTGACCTTCCTGTGATGTCCATACATGGAAAACAACAACAAACGAAGCGTACAACAACATTCTTCCAGTTTTGCAATGCTGAATCTGGTATACTACTTTGTACTGATGTCGCGGCGCGTGGTCTGGACATTCCGGCCGTTGATTGGATTGTACAGTATGATCCTCCAGATGATCCAAAGGAATACATCCATCGGGTTGGAAGAACTGCGAGGGGTCTAGGAACTAGTGGACACGCTTTGTTATTCTTACGTCCAGAAGAGCTTGGATTCTTACGATACTTAAAGCAGTCGAGAGTTACCCTAAACGAATTTGAATTCTCATGGAATAAAGTTGCAGATATACAACTACAGCTAGAAAAACTTATCTCTCGAAACTATTTCCTGAATCAATCTGCAAAAGAAGCCTTCAAAAGTTACCTGAGAGCCTATGATTCTCATCACTTGAAAACGATTTTTGACATTGATACAATCGATTTAGCTAAGGCATCGAAATCATTTGGTTTCAATGTACCGCCCGCTGTAGAACTAAAAGTCGCAAACAAAGGACCTCCACAGAAAAGAAAGGGAGGTGGTGGTTATGGATACTTCAAGTCCTTAAACGCTCCATCCGATTTCAAAAGGAAGACAGATAAAACGAAAATATACAGACAAAAGGGGAACAATAAGAAAACGATCAGTTGA
Protein
MPTPDKILLRKIRKREKRKLKLTSQKTDSNPEPEKDIEALNNEKEAKKRVVQDGDTNGKVPKKKLKKVKEELKEEPVEVKSEEESSDDSQDEQDTKEDDSEKKSNNDLPGSSLCLGILSDQKFTALEGTVCEPTLLGIKDMGFITMTEIQAKAIPPLLEGRDLVGAAKTGSGKTLAFLIPAIDLIYKLKFKPRNGTGVIILSPTRELSMQTFGVLMELMKYHHHTYGLVMGGANRSTEAQKLSKGINILVATPGRLLDHLQNTPDFLYKNLQCLVIDEADRILEIGFEEEVKQIIKLLPKRRQTMLFSATQTKKTEALTALALKHEPVYVGVDDHREQATVDSLEQGYIVCPSEKRMMVLFTFLKKNRKKKVMVFFSTCMSVKYHHELFNYIDLPVMSIHGKQQQTKRTTTFFQFCNAESGILLCTDVAARGLDIPAVDWIVQYDPPDDPKEYIHRVGRTARGLGTSGHALLFLRPEELGFLRYLKQSRVTLNEFEFSWNKVADIQLQLEKLISRNYFLNQSAKEAFKSYLRAYDSHHLKTIFDIDTIDLAKASKSFGFNVPPAVELKVANKGPPQKRKGGGGYGYFKSLNAPSDFKRKTDKTKIYRQKGNNKKTIS

Summary

Description
Probable RNA-dependent helicase. Functions in cell growth and proliferation. May have a role in ribosome biogenesis and, consequently, in protein biosynthesis.
Catalytic Activity
ATP + H2O = ADP + H(+) + phosphate
Miscellaneous
Mutation in the pit gene produce larvae that cannot grow beyond the first instar larval stage although they can live as long as 7-10 days. All the tissues are equally affected and the perfectly shaped larvae are indistinguishable from first instar wild-type animals.
'Pitchoune' means 'small' in Provence (Southern part of France).
Similarity
Belongs to the DEAD box helicase family.
Belongs to the DEAD box helicase family. DDX18/HAS1 subfamily.
Keywords
ATP-binding   Complete proteome   Helicase   Hydrolase   Nucleotide-binding   Nucleus   Reference proteome   RNA-binding  
Feature
chain  Probable ATP-dependent RNA helicase pitchoune
EC Number
3.6.4.13
EMBL
KZ150004    PZC75254.1    NWSH01002631    PCG67801.1    AGBW02010074    OWR49215.1    + More
GAIX01004010    JAA88550.1    BABH01009406    KQ459589    KPI97469.1    JTDY01001746    KOB73007.1    KQ971312    EEZ98368.1    LJIG01000276    KRT86664.1    GEZM01055754    JAV72948.1    NEVH01000599    PNF43502.1    GEDC01004386    JAS32912.1    KQ435824    KOX72228.1    KQ981625    KYN39123.1    ADTU01015209    GBYB01001815    JAG71582.1    GL763877    EFZ19207.1    GDAI01001998    JAI15605.1    KQ976574    KYM80238.1    KQ980107    KYN17693.1    KQ434813    KZC06784.1    DS235851    EEB18709.1    KK107063    EZA61209.1    GDHC01000957    JAQ17672.1    APGK01017820    KB740053    ENN81801.1    KB632093    ERL88693.1    GAMC01007082    JAB99473.1    GGMR01002494    MBY15113.1    GFXV01000294    MBW12099.1    UFQT01000292    SSX22905.1    GGMS01009625    MBY78828.1    CCAG010017460    JRES01000501    KNC30690.1    CH480815    EDW43133.1    AE014297    AHN57458.1    CH902617    EDV42585.1    CH954182    EDV54198.1    U84552    AY071402    AY119620    CH933806    EDW16314.1    ABLF02029216    CM000160    EDW97949.1    GDHF01032633    JAI19681.1    CM000070    EDY68110.1    GAKP01021350    GAKP01021349    JAC37603.1    KRG02045.1    KRG02044.1    CH940650    EDW67321.1    OUUW01000005    SPP80279.1    KK853180    KDR10194.1    KRF83246.1    CP012526    ALC47404.1    QOIP01000005    RLU22532.1    CH916373    EDV94409.1    KQ415041    KOC58877.1    KQ982294    KYQ58210.1    CH964272    EDW84676.1    GECZ01007597    JAS62172.1    KA648066    AFP62695.1    CVRI01000070    CRL07099.1    GDIQ01016212    JAN78525.1    GDIQ01215846    GDIQ01215845    GDIQ01110641    JAK35880.1    GDIQ01044008    JAN50729.1    GDIQ01046052    JAN48685.1    GDIQ01044007    JAN50730.1    GDIP01180278    JAJ43124.1    GDIQ01211896    JAK39829.1    GDIQ01160109    JAK91616.1    GDIQ01095090    JAL56636.1    GDIQ01136922    JAL14804.1    GDIQ01160108    JAK91617.1    GDIP01195228    JAJ28174.1    GDIP01218079    JAJ05323.1    GDIP01161528    GDIQ01064054    JAJ61874.1    JAN30683.1    GDIQ01129677    LRGB01000687    JAL22049.1    KZS17013.1    GDIP01208028    JAJ15374.1    GDIQ01158013    JAK93712.1    GDIQ01147178    JAL04548.1    GDIQ01108734    JAL42992.1    GDIQ01214147    JAK37578.1    GDIQ01075947    JAN18790.1    GDIQ01145826    JAL05900.1    GDIP01110037    JAL93677.1    GDIQ01120777    JAL30949.1    GDIQ01108733    JAL42993.1    GDIQ01229241    JAK22484.1    GDIQ01108732    JAL42994.1    GDIP01102489    JAM01226.1    GDIQ01081893    JAN12844.1    GBBI01002310    JAC16402.1    GDIP01053657    JAM50058.1    GDIQ01176847    JAK74878.1   
Pfam
PF13959   DUF4217        + More
PF00271   Helicase_C
PF00270   DEAD
PF09531   Ndc1_Nup
PF00013   KH_1
PF16544   STAR_dimer
Interpro
IPR000629   RNA-helicase_DEAD-box_CS        + More
IPR014014   RNA_helicase_DEAD_Q_motif       
IPR011545   DEAD/DEAH_box_helicase_dom       
IPR025313   DUF4217       
IPR027417   P-loop_NTPase       
IPR001650   Helicase_C       
IPR014001   Helicase_ATP-bd       
IPR019049   Nucleoporin_prot_Ndc1/Nup       
IPR036612   KH_dom_type_1_sf       
IPR004088   KH_dom_type_1       
IPR032377   STAR_dimer       
IPR004087   KH_dom       
SUPFAM
SSF52540   SSF52540        + More
SSF54791   SSF54791       
Gene 3D
PDB
6EM5     E-value=1.09598e-169,     Score=1533

Ontologies

Topology

Subcellular location
  
Length:
617
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00504999999999999
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00050
outside
1  -  617
 
 

Population Genetic Test Statistics

Pi
234.21002
Theta
156.151962
Tajima's D
1.466759
CLR
0
CSRT
0.778361081945903
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号