SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03474
Pre Gene Modal
BGIBMGA006524
Annotation
PREDICTED:_ATP-dependent_RNA_helicase_DDX18-like_isoform_X2_[Bombyx_mori]
Full name
RNA helicase       + More
ATP-dependent RNA helicase DDX18      
Alternative Name
DEAD box protein 18
Myc-regulated DEAD box protein
Location in the cell
Mitochondrial   Reliability : 2.065
 

Sequence

CDS
ATGAGCGCTAACGATATTTATCCTAAGTGTACATTTTCCATGCTCAAAGGTGCAGCTAAAACAGGAAGTGGAAAAACATTAGCTTTCTTAATACCTGCTGTAGATCAACTTATTAAACTTGGATTTACACTAAAACATGGTACAGGTTGCATCATTCTATCTCCAACAAGAGAATTAGCTCTGCAGACATTTGAAGTACTAAAGAGACTCTTGACAGATATTGATATTTCACATTGCTTGATTGTTGGAGGTGAGAAAAAAAATAAGGATGTGTCCAAGCTACAAAAAGGCATGAATATTGTAGTGAGTACTCCTGGAAGACTTCTTGATCATTTACAAACCACAAACACATTTAATTGCAAAAATCTGAAATGTCTTATAATTGATGAAGCTGATAAACTGTTAGAATCTGGCTTTGAAAAGCATGTAAATGGAATACTGGAAAAACTTCCAAATGATAAACAAACCGTTCTTTTTAGTGCAACGATTGATGATAGAGTTAAGAATCTAGCTAGACTGGCGTTGAGGAGCGATCCGATCTGGATAACTGTTGATGATGACGCAAAGCGGTCCACTGTCTCTGGATTGCAACAGGGGTACTACATTTGCCCAGTAGAAAAAAGAATGGCTTGGTTGTACAAGATGTTGAAGAAGTGCAAGAAACTGAAAGTCATGGTGTTTTTCTCATCGTGTAAATCGGTCGATTTTCATTATGAATTCTTTAGAGTGAATTGTAAGGCAATCGTCTCTAGTATACACGGCAGACAAAGCCAGGCCAAAAGAAAAGAAGCCTATCACGGTTTCGTGGAAGCACAAAACGGTGCGTTGTTCTGTACCGATGTCGCCGCGAGAGGACTGGACATACCGAGCGTCGATTGGATTGTCCAATACGACCCTCCCACTGACCCTAAGGAGTACATACATAGAGTTGGACGTACCGCCCGAGGTATGAACAGCAAAGGCAATGCAGTGATATTACTTAGACCAGAGGAAGAGGAATTCGTGAAGTTCTTAGAGAACGAAAAAGTTTATTTAGATAAATACACTTTTGGCGATCCCCCGGCAGACATACAAGAATTTCTTCAAAAACTAATAAAAGAGAACGGAGTTATGAAAGTTTTGGCGAGAAAAGCTTTTCTTTCGTTTTTACGTTGTTATAAAAATCATCCACTGAAGAGTATTTTTAATATCAAAAATCTGAATCTACAGTTGGCATCAAAAGCCTTTGGATTTGATGAAACGCCTCATGTCGATTTCTTACGTTCTAAATGA
Protein
MSANDIYPKCTFSMLKGAAKTGSGKTLAFLIPAVDQLIKLGFTLKHGTGCIILSPTRELALQTFEVLKRLLTDIDISHCLIVGGEKKNKDVSKLQKGMNIVVSTPGRLLDHLQTTNTFNCKNLKCLIIDEADKLLESGFEKHVNGILEKLPNDKQTVLFSATIDDRVKNLARLALRSDPIWITVDDDAKRSTVSGLQQGYYICPVEKRMAWLYKMLKKCKKLKVMVFFSSCKSVDFHYEFFRVNCKAIVSSIHGRQSQAKRKEAYHGFVEAQNGALFCTDVAARGLDIPSVDWIVQYDPPTDPKEYIHRVGRTARGMNSKGNAVILLRPEEEEFVKFLENEKVYLDKYTFGDPPADIQEFLQKLIKENGVMKVLARKAFLSFLRCYKNHPLKSIFNIKNLNLQLASKAFGFDETPHVDFLRSK

Summary

Catalytic Activity
ATP + H2O = ADP + H(+) + phosphate
Subunit
Interacts with NOL8; the interaction is RNA-dependent.
Similarity
Belongs to the DEAD box helicase family.
Belongs to the DEAD box helicase family. DDX18/HAS1 subfamily.
Keywords
3D-structure   ATP-binding   Chromosome   Complete proteome   Direct protein sequencing   Helicase   Hydrolase   Nucleotide-binding   Nucleus   Polymorphism   Reference proteome   RNA-binding  
Feature
chain  ATP-dependent RNA helicase DDX18
sequence variant  In a breast cancer sample; somatic mutation.
EC Number
3.6.4.13
EMBL
NWSH01002631    PCG67802.1    KZ150004    PZC75255.1    ODYU01004177    SOQ43768.1    + More
KQ459896    KPJ19451.1    KQ459589    KPI97470.1    GAIX01004109    JAA88451.1    JTDY01001746    KOB73010.1    JP008464    AER97061.1    JH883501    ELR46355.1    GL192967    EFB20498.1    AC009404    AAX88947.1    AMGL01054442    KK113246    KFM59691.1    GFFW01000630    JAV44158.1    AEYP01049577    ABGA01338421    ABGA01338422    ABGA01338423    AAPE02035807    AAPE02035808    DP000561    ABY74563.1    KB031068    ELK04560.1    AANG04001482    CABD030015109    ADFV01086491    ADFV01086492    ADFV01086493    GBZA01000170    JAG69598.1    AC172375    GABC01002832    GABF01005921    GABD01005231    GABE01007542    NBAG03000272    JAA08506.1    JAA16224.1    JAA27869.1    JAA37197.1    PNI53565.1    AJFE02065096    NDHI03003416    PNJ58661.1    DP000699    ACC62099.1    AGTP01000913    CH471103    EAW95194.1    AK001467    BC001238    BC003360    BC024739    X98743    CR457060    GAMT01000484    GAMS01004609    GAMR01004114    GAMP01003051    JAB11377.1    JAB18527.1    JAB29818.1    JAB49704.1    AAQR03093401    AAQR03093402    HG805960    CDW55517.1    AHZZ02003617    DP000513    ABX89268.1    AEMK02000098    DP000762    ACE73640.1    JV489178    AFJ70212.1    KA648066    AFP62695.1    AQIB01162610    JU336941    JU477673    AFE80694.1    AFH34477.1    GDAI01001998    JAI15605.1    AQIA01014040    DP001024    ACJ72832.1    AC128353    BC083919    AAH83919.1    BC141230    BC141231    CH466520    AAI41231.1    EDL39784.1    AK075864    AK019845    BC028246    BC103776    RAZU01000200    RLQ66352.1    AAGW02005285    AAEX03011884    DP001104    ACQ63054.1    ADON01077451    ATLV01012386    KE524787    KFB36695.1    HADX01006126    SBP28358.1    CM001288    EHH55889.1    AAKN02006738    AERX01027326    GFDL01015102    JAV19943.1    DS232108    EDS35043.1    GGFK01005708    MBW39029.1   
Pfam
PF00270   DEAD        + More
PF13959   DUF4217
PF00271   Helicase_C
Interpro
IPR027417   P-loop_NTPase        + More
IPR025313   DUF4217       
IPR014014   RNA_helicase_DEAD_Q_motif       
IPR011545   DEAD/DEAH_box_helicase_dom       
IPR000629   RNA-helicase_DEAD-box_CS       
IPR014001   Helicase_ATP-bd       
IPR001650   Helicase_C       
SUPFAM
SSF52540   SSF52540       
PDB
6EM5     E-value=3.21166e-97,     Score=907

Ontologies

Topology

Subcellular location
Nucleus  
Nucleolus  
Chromosome  
Length:
423
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.39514
Exp number, first 60 AAs:
0.39211
Total prob of N-in:
0.03194
outside
1  -  423
 
 

Population Genetic Test Statistics

Pi
175.324825
Theta
17.496038
Tajima's D
0.355646
CLR
0.469895
CSRT
0.481825908704565
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号