SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03472
Pre Gene Modal
BGIBMGA012392
Annotation
PREDICTED:_RNA-directed_DNA_polymerase_from_mobile_element_jockey-like_[Diaphorina_citri]
Location in the cell
Cytoplasmic   Reliability : 2.645
 

Sequence

CDS
ATGAATGAGGAGAACGACTGGAATAGAGTGATTAATAGGAAGCCAGAGAACGTCGGATTTGTGAATGAGATTAGTATGTATGAAGTTAGAGAAGCAGTGAGAAGTATGAAAAGCGGAAAATCGGAAGGACCAGACGGTATACCAGTGGAAGTATGGAAGATACTGGGAGAAGACGGATATAAGTGGCTGACTTTATTCTTCAATAAGCTGCTGCAAGAAGAAGTGATCCCTACGGAATGGAGCATCAGTACGCTGGTGCCCATATACAAAAATAAAGGGGATGTGCAAGACTGTGGCAGCTATCGGGGAATAAAGCTTATGTCTCATAGTATGAAAGTTTGGGAGAAAGTGATAGAAAAGCGATTGCGAGATGAAAGTGAGATCACCCAAAACCAGTTCGGGTTCATGCCTGGTCGCGGGACAACGGACGCCATATTTGCACTACGCCAAGTGTGCGAAAAACATCGCGACGTGCACAGGAATCTGCATATGGTGTTCGTTGATCTAGAAAAAGCGTACGACCGAGTACCTAGAGTAGTTTTGTGGTGGGCATTGAATGAGAAAGGTATACCTGGTAAGTATGTGAGGTTAATCTGTGCCATGTACAGTCGAGCCAGGACGTATGTACGAACCGCCGCGGGGAATTCCGACGAGTTCAATGTGGCAGTGGGCTTACACCAAGGGTCTGCACTAAGTCCCTATCTCTTCCTGCTTGTGATGGATGCCTTGACATCGGAGATACAGGAAGAGCCCCCTTGGTGTATGCTGTTTGTCGATGACATAGTACTCGTCGGAGAAAACGGGCTCGAGGTCCAAAACATACTGGAGAAATGGCGATGCAAGTTGGAGAGTGTTGGCCTAAAAATCAGCAGATCGAAAACCGAACATCTGTTCTGTGATTTTGGCGGTCTCTCCAATTTTACACCCATTTCCCTCGACGGAACACCTTTGCCAGTATGTCAAGACTTCCGATACCTAGGGTCTGTTATCCAAAGCGACGGTGAACTGGATCGTACTGTGAGGCACAGAATTGACGCAGGATGGATGAAATGGCGGCAGGTCACGGGCACCATATGTGACTCGCACATCCCTCTTCCCCTAAAAGGGAAGATATATAAGACCTTAATAAGGCCTGCCGTCTTGTATGGATCAGCTTGTTGGACAACGAAAGTGGCGGATGAAAGGCGATTGCATGCAGCAGAGATGCGAATGTTGCGATGGATGTGTGGAGTAACGAGAATGGATAGAATACGGAATGAATATGTTAGAGGAAGTCTGAAAGTGGCACCTGTGACAGAGAAGCTGAGGAGTGCACGTTTGGGATGGTATGGACATGTGATGAGACGGAATGAAAATGAGGTTGTTAAGAGAGTGTTAACTATGAATGTGGAAGGATTTAGAGGAAGAGGTAGACCTAAGAAGAAATGGATGGATTGTGTGAAAGACGATATGGGTAGGAGGGGAGTGAGCGAAGAAATGGTATATGATAGAAGAGTATGGAAGGAGAAAACATGTTGCGCCGACCCCAGGTGA
Protein
MNEENDWNRVINRKPENVGFVNEISMYEVREAVRSMKSGKSEGPDGIPVEVWKILGEDGYKWLTLFFNKLLQEEVIPTEWSISTLVPIYKNKGDVQDCGSYRGIKLMSHSMKVWEKVIEKRLRDESEITQNQFGFMPGRGTTDAIFALRQVCEKHRDVHRNLHMVFVDLEKAYDRVPRVVLWWALNEKGIPGKYVRLICAMYSRARTYVRTAAGNSDEFNVAVGLHQGSALSPYLFLLVMDALTSEIQEEPPWCMLFVDDIVLVGENGLEVQNILEKWRCKLESVGLKISRSKTEHLFCDFGGLSNFTPISLDGTPLPVCQDFRYLGSVIQSDGELDRTVRHRIDAGWMKWRQVTGTICDSHIPLPLKGKIYKTLIRPAVLYGSACWTTKVADERRLHAAEMRMLRWMCGVTRMDRIRNEYVRGSLKVAPVTEKLRSARLGWYGHVMRRNENEVVKRVLTMNVEGFRGRGRPKKKWMDCVKDDMGRRGVSEEMVYDRRVWKEKTCCADPR

Summary

Similarity
Belongs to the major facilitator superfamily. Sugar transporter (TC 2.A.1.1) family.
Uniprot
A0A2A4IZ11   A0A151QVZ1   A0A1D6MK44   A0A1D6FKL0   A0A3L6DEY6   A0A1D6FKL2   + More
A0A1D6FKM0   A0A3L6E1R1   A0A1D6IMH2   A0A317Y223   A0A1D6GGM3   A0A1D6JF34   A0A1D6FKK2   A0A1D6Q028   A0A1D6KX85   A0A1D6G0V4   A0A1D6LAQ1   A0A1D6I601   A0A1D6KG90   A0A1D6JIM9   A0A1D6K060   A0A317Y9W4   A0A1D6H1V1   A0A1D6M7A6   A0A1D6P0V1   A0A1D6PU65   A0A1D6H871   A0A1D6MYV7   A0A1D6NCE0   A0A317Y8S7   A0A1D6JJN9   A0A1D6FJU8   A0A1D6HX90   A0A1D6LC02   A0A1D6LFI2   A0A3L6FLU6   A0A1D6I7A1   A0A1D6K3M7   A0A1D6JQ10   A0A3L6FHK1   A0A1D6LXZ4   A0A1D6KLY6   A0A1D6J5H5   A0A1D6I351   A0A1D6FKM1   A0A3L6EF28   A0A1D6KWI6   A0A1D6G503   A0A1D6KVT7   A0A1D6I607   A0A1D6MV72   A0A1D6GRX4   A0A317YB76   A0A1D6HE72   A0A3L6G913   A0A3L6GA57   A0A3P9IMA9   A0A3B3HQB6   A0A1D6L213   A0A3B3HS69   A0A2I0VMH1   A0A3B3IC33   A0A3B3BCY6   A0A3B3I8S7   A0A3P9H8X2   A0A3P9K727   A0A3P9JDN6   A0A3B3H692   A0A3B3IFA0   A0A3B3IC09   A0A3B3IEV4   A0A3P9K1J1   A0A3B3IM62   A0A3P9MDZ4   A0A3P9H8W7   A0A3P9JLZ1   A0A3P9IJG8   A0A3B3H6E8   A0A3P9IXB6   A0A3P9JAC7   A0A3B3HJZ3   A0A3P9KEZ0   A0A3B3HJS0   A0A3B3IAI6   A0A3B3HY61   A0A3P9HQQ4   A0A3B3HT45   A0A3B3HQW9   A0A3P9MAU2   A0A3B3HQU7   A0A3P9I3Z4   A0A3B3I636   A0A3B3H8Q9   A0A3B3ILR3   A0A3B3INX9   A0A3P9K4Q4   A0A3B3HJN2   A0A3B3IDD8   A0A3P9M3S5   A0A3B3IIA9  
Pfam
PF00078   RVT_1        + More
PF03372   Exo_endo_phos
PF00083   Sugar_tr
PF01300   Sua5_yciO_yrdC
PF14529   Exo_endo_phos_2
PF05608   DUF778
PF04937   DUF659
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR036882   Alba-like_dom_sf       
IPR005828   MFS_sugar_transport-like       
IPR003663   Sugar/inositol_transpt       
IPR005829   Sugar_transporter_CS       
IPR036259   MFS_trans_sf       
IPR020846   MFS_dom       
IPR017945   DHBP_synth_RibB-like_a/b_dom       
IPR006070   YrdC-like_dom       
IPR027124   Swc5/CFDP2       
IPR008496   TMEM222/RTE1       
IPR007021   DUF659       
IPR012337   RNaseH-like_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF82704   SSF82704       
SSF103473   SSF103473       
SSF55821   SSF55821       
SSF53098   SSF53098       
Gene 3D
ProteinModelPortal
A0A2A4IZ11   A0A151QVZ1   A0A1D6MK44   A0A1D6FKL0   A0A3L6DEY6   A0A1D6FKL2   + More
A0A1D6FKM0   A0A3L6E1R1   A0A1D6IMH2   A0A317Y223   A0A1D6GGM3   A0A1D6JF34   A0A1D6FKK2   A0A1D6Q028   A0A1D6KX85   A0A1D6G0V4   A0A1D6LAQ1   A0A1D6I601   A0A1D6KG90   A0A1D6JIM9   A0A1D6K060   A0A317Y9W4   A0A1D6H1V1   A0A1D6M7A6   A0A1D6P0V1   A0A1D6PU65   A0A1D6H871   A0A1D6MYV7   A0A1D6NCE0   A0A317Y8S7   A0A1D6JJN9   A0A1D6FJU8   A0A1D6HX90   A0A1D6LC02   A0A1D6LFI2   A0A3L6FLU6   A0A1D6I7A1   A0A1D6K3M7   A0A1D6JQ10   A0A3L6FHK1   A0A1D6LXZ4   A0A1D6KLY6   A0A1D6J5H5   A0A1D6I351   A0A1D6FKM1   A0A3L6EF28   A0A1D6KWI6   A0A1D6G503   A0A1D6KVT7   A0A1D6I607   A0A1D6MV72   A0A1D6GRX4   A0A317YB76   A0A1D6HE72   A0A3L6G913   A0A3L6GA57   A0A3P9IMA9   A0A3B3HQB6   A0A1D6L213   A0A3B3HS69   A0A2I0VMH1   A0A3B3IC33   A0A3B3BCY6   A0A3B3I8S7   A0A3P9H8X2   A0A3P9K727   A0A3P9JDN6   A0A3B3H692   A0A3B3IFA0   A0A3B3IC09   A0A3B3IEV4   A0A3P9K1J1   A0A3B3IM62   A0A3P9MDZ4   A0A3P9H8W7   A0A3P9JLZ1   A0A3P9IJG8   A0A3B3H6E8   A0A3P9IXB6   A0A3P9JAC7   A0A3B3HJZ3   A0A3P9KEZ0   A0A3B3HJS0   A0A3B3IAI6   A0A3B3HY61   A0A3P9HQQ4   A0A3B3HT45   A0A3B3HQW9   A0A3P9MAU2   A0A3B3HQU7   A0A3P9I3Z4   A0A3B3I636   A0A3B3H8Q9   A0A3B3ILR3   A0A3B3INX9   A0A3P9K4Q4   A0A3B3HJN2   A0A3B3IDD8   A0A3P9M3S5   A0A3B3IIA9  
PDB
6AR3     E-value=0.000780246,     Score=102

Ontologies

Topology

Length:
510
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.02222
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00892
outside
1  -  510
 
 

Population Genetic Test Statistics

Pi
138.291602
Theta
26.39901
Tajima's D
1.331679
CLR
1.007976
CSRT
0.747812609369532
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号