SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03461
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
Probable RNA-directed DNA polymerase from transposon BS       + More
Probable RNA-directed DNA polymerase from transposon X-element      
Alternative Name
Reverse transcriptase
Location in the cell
Mitochondrial   Reliability : 1.22 Nuclear   Reliability : 1.284 PlasmaMembrane   Reliability : 1.154
 

Sequence

CDS
ATGGTCAGGAACGACAGGCTCTCTGCCCGTGGTGGTGGTACCGTCATTTACTATAGAAGAGCCCTGCATTGCGTCCCGCTCGATCCTCCCGCGCTCGCTAATATCGAAGCATCAGTGTGCCGAATCTCACTGACGGGACACGCGCCGATCGTTATCGCGTCCGTTTATCTTCCACCGGATAAGATCGTTCTAAGCAGTGATATCGAGGCGCTGCTCGGTATGGGGAGCTCTGTCATTCTGGCGGGCGACCTAAATTGTAAACACATCAGGTGGAACTCACACACCACAACCCCGAATGGCAGGCGGCTTGACGCGTTAGTCGATGATCTCGCCTTCGATATCGTCGCTCCGCTAACCCCGACTCACTACCCGCTAAATATCGCGCATCGCCCGGATATACTCGACATAGCGTTATTAAAAAACGTAACTCTGCGCTTACACTCGATCGAAGTAGTTTCAGAGTTAGATTCAGACCACCGTCCCGTCGTTATGAAGCTCGGTCGCGCTCCCGATTCCGTTCCCGTCACGAGGACTGTGGTGGATTGGCACACGCTGGGCATCAGCCTGGCTGAATCTGATCCACCATCGCTCCCGTTTAACCCGGACTCTATCCCGTCTCCTCAGGATACCGCTGAAGCCATAGACATCTTAACGTCACACATCACCTCGACATTAGATAGGTCATCGAAACAAGTTGTAGCGGAGGACTTCCTTCACCGCTTCAAATTGTCCGACGATATTAGGGAACTCCTTAGAGCTAAGAACGCCTCGATACGCGCCTACGACAGGTATCCTACCGCGGAAAATCGTATTCGAATGCGTGCCCTACAACGCGACGTAAAGTCTCGCATCGCCGAAGTCCGAGATGCCAGATGGTCTGATTTCTTAGAAGGACTCGCGCCCTCCCAAAGGTCTTACTACCGCTTAGCTCGTACTCTCAAATCGGATACGGTAGTAACTATGCCCCCCCTCGTAGGCCCCTCAGGCCGACTCGCGGCGTTCGATGATGACGAAAAAGCAGAGCTGCTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCACTCAATCCGTGGACCCTGTTCATGTAGAATTAGTAGACAGTGAGGTAGAACGCAGAGCCTCCTTGCCACCCTCTGATGCGTTACCACCCGTCACCCCGATGGAAGTTAAAGACTTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACGGTATATCCAACCGCGTTATTAAACTTCTACCCGTCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCGAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACATAAACCCGGTAAACCAAAAAATCATCCGACGAGCTACCGCCCGATTAGCCTCCTCATGTCTCTAGGCAAACTGTATGAGCGTCTGCTCTACAAACGCCTCAGAGACTTCGTCTCATCCAAGGGCATTCTTATCGATGAACAATTCGGATTCCGTACAAATCACTCATGCGTTCAACAGGTGCACCGCCTCACGGAGCACATTCTTGTGGGGCTTAATCGACCAAAACCGTTATACACGGGAGCTCTCTTCTTCGACGTCGCAAAAGCGTTTGACAAAGTCTGGCACAATGGTTTGATTTTCAAACTATTCAACATGGGCGTGCCGGATAGTCTCGTGCTCATCATACGGGACTTCTTGTCGAACCGCTCTTTTCGATATCGAGTCGAGGGAACCCGCTCCTCCCCACGACCTCTCACAGCTGGAGTCCCGCAAGGCTCTGTCCTCTCACCCCTCCTATTTAGCTTATTCGTCAACGATATTCCCCGGTCGCCGCCGACCCATTTAGCTTTATTCGCCGACGACACGACTGTTTACTATTCTAGTAGAAATAAGTCCCTAATCGCGAAGAAGCTTCAGAGCGCAGCCCTAGCCCTAGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCAGCGAAAAGTACTGCGGTGCTATTTCAGAGGGGAAGCTCCACACGGATTTCCTCCCGGATTAGGAGGAGGAATCTCACACCCCCGATTACTCTCTTTAGACAACCCATACCCTGGGCCAGGAAGGTCAAGTACCTGGGCGTTACCCTGGATGCATCGATGACACAATATGCGTTAGCATTCATAGCAATTATTTGTTCAAATTTTAAGAGAATATTTGGGGAAATCAATAGTAATAGTATCTCGCGTCAGTAA
Protein
MVRNDRLSARGGGTVIYYRRALHCVPLDPPALANIEASVCRISLTGHAPIVIASVYLPPDKIVLSSDIEALLGMGSSVILAGDLNCKHIRWNSHTTTPNGRRLDALVDDLAFDIVAPLTPTHYPLNIAHRPDILDIALLKNVTLRLHSIEVVSELDSDHRPVVMKLGRAPDSVPVTRTVVDWHTLGISLAESDPPSLPFNPDSIPSPQDTAEAIDILTSHITSTLDRSSKQVVAEDFLHRFKLSDDIRELLRAKNASIRAYDRYPTAENRIRMRALQRDVKSRIAEVRDARWSDFLEGLAPSQRSYYRLARTLKSDTVVTMPPLVGPSGRLAAFDDDEKAELLADTLQTQCTPSTQSVDPVHVELVDSEVERRASLPPSDALPPVTPMEVKDLIKDLRPRKAPGSDGISNRVIKLLPVQLIVMLASIFNAAMANCIFPAVWKEADVIGIHKPGKPKNHPTSYRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRTNHSCVQQVHRLTEHILVGLNRPKPLYTGALFFDVAKAFDKVWHNGLIFKLFNMGVPDSLVLIIRDFLSNRSFRYRVEGTRSSPRPLTAGVPQGSVLSPLLFSLFVNDIPRSPPTHLALFADDTTVYYSSRNKSLIAKKLQSAALALGQWFRKWRIDINPAKSTAVLFQRGSSTRISSRIRRRNLTPPITLFRQPIPWARKVKYLGVTLDASMTQYALAFIAIICSNFKRIFGEINSNSISRQ

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
At least 30 copies of X-element are present in the genome and some elements are polymorphic between different strains.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  Probable RNA-directed DNA polymerase from transposon BS
EC Number
2.7.7.49
EMBL
U07847    AAA17752.1    AB055391    BAB21761.1    AB018558    BAA76304.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    GEZM01008457    JAV94772.1    KQ973342    KXZ75569.1    GALX01005299    JAB63167.1    KQ971729    KYB24751.1    ABLF02042518    ABLF02057746    GBBI01004395    JAC14317.1    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    GGMS01006359    MBY75562.1    ABLF02008153    ABLF02008462    ABLF02008464    GALX01005359    JAB63107.1    GGMR01018716    MBY31335.1    ABLF02028535    ABLF02028545    GGMR01004661    MBY17280.1    NEVH01005277    PNF39135.1    ABLF02034467    NEVH01021205    PNF19912.1    NEVH01011985    PNF31054.1    NEVH01009134    PNF33528.1    ABLF02023911    NEVH01027074    PNF13841.1    ABLF02040174    ABLF02040183    ABLF02055266    GFTR01008038    JAW08388.1    ABLF02041767    GBBI01004571    JAC14141.1    NEVH01006736    PNF36716.1    GGMR01013409    MBY26028.1    GEZM01099921    GEZM01099920    GEZM01099918    GEZM01099906    JAV53125.1    GGMR01000226    MBY12845.1    GFTR01007929    JAW08497.1    NEVH01023280    PNF18085.1    GFTR01008256    JAW08170.1    NEVH01017470    PNF24199.1    GFTR01008262    JAW08164.1    ABLF02024246    GFTR01008279    JAW08147.1    GGMR01016905    MBY29524.1    KK118005    KFM71947.1    KK119261    KFM75202.1    GFTR01008271    JAW08155.1    GGMR01003864    MBY16483.1    ABLF02016634    GGMR01000676    MBY13295.1    GFTR01008251    JAW08175.1    GGMS01017365    MBY86568.1    NEVH01002556    PNF42024.1    GGMR01012443    MBY25062.1    GEZM01053022    JAV74219.1    GFTR01008261    JAW08165.1    NEVH01022639    PNF18527.1    KK113281    KFM59799.1    GFTR01008260    JAW08166.1    GFXV01000908    MBW12713.1    GFTR01008151    JAW08275.1    GGMR01003407    MBY16026.1    GGMS01002992    MBY72195.1    NEVH01016302    PNF25823.1    GEZM01084969    JAV60363.1    ABLF02014118    ABLF02014121    ABLF02054790    GGMS01002955    MBY72158.1    GECL01003538    JAP02586.1    GGMR01015412    MBY28031.1    GGMR01006408    MBY19027.1    GGFL01004957    MBW69135.1    NWSH01007753    PCG62823.1    GFTR01008257    JAW08169.1    NNAY01003095    OXU19992.1    GFTR01008246    JAW08180.1    KF280391    AIE77315.1    GFXV01002840    MBW14645.1    GGMR01012305    MBY24924.1    AY060438    AAL25477.1    GGFL01005012    MBW69190.1    GGMR01012676    MBY25295.1    GGMS01002786    MBY71989.1    GEZM01021881    JAV88842.1    GGMS01006655    MBY75858.1    RPOV01000134    RPJ78669.1    KK119692    KFM76444.1    LBMM01013518    KMQ85605.1    S59870    AAB26437.2    ABLF02041861    GGMR01011511    MBY24130.1    GFTR01008269    JAW08157.1    GGMR01014053    MBY26672.1    GGMS01000737    MBY69940.1    AF237761    AAF81411.1    ABLF02029306    ABLF02029314    ABLF02060138    GGMR01002322    MBY14941.1    KU543685    AMS38375.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
PF07727   RVT_2
PF10551   MULE
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
IPR013103   RVT_2       
IPR013083   Znf_RING/FYVE/PHD       
IPR018289   MULE_transposase_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
744
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
9.28443999999999
Exp number, first 60 AAs:
0.05465
Total prob of N-in:
0.03455
outside
1  -  744
 
 

Population Genetic Test Statistics

Pi
17.823535
Theta
18.050318
Tajima's D
0
CLR
0.000988
CSRT
0.373231338433078
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号