SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03441
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.007 Nuclear   Reliability : 1.565 PlasmaMembrane   Reliability : 1.098
 

Sequence

CDS
ATGTGTGTGTGTCAAATACATGGCAATGTCGCGCCGATCGTTATCGCGTCTGTTTATCTTCCACCGGATAAGATCGTTTTAAGCAGTGATATCGAGGCGCTGCTCAGCATGGGAAGCTCTGTCATTCTGGCGGGCGACCTAAATTGTAAACACATCAGGTGGAACTCTCACACCACAACCCCTAATGGCCGGCGGCTCGACGCGTTAGTCGATGATCTCACCTTCGATATCATCGCTCCGCTAACCCCGACTCACTACCCGCTAAATATCGCGCATCGCCCGGATATACTCGACATAGCGTTATTAAAAAATGTAGCTCTGCGCTTACACTCGATTGAAGTAGTTTCAGAGTTAGATTCAGACCACCGTCCCGTCGTTATGAAGCTCGGTCGCGCTCCCGATTCCGTTCCCGTCACGAGGACTGTGGTGGATTGGCACACGTTGGGCATCAGTCTGGCTGAATCTAATCCACCATCGCTCCCGTTTAACCCGGACTCTACCCCGTCTCCTCAGGATACCGCTGAAGCCATAGACATCTTAACGTCACACATCAACTCGACATTAGATAGGTCATCGAAACAAGTTGTAGCGGAGGACTTCCTTCACCGCTTCAAATTGTCCGACGATATTAGGGAACTCCTTAGAGCTAAGAACGCCTCGATACGCGCCTACGACAGGTATCCTACCGCGGAAAATCGTATTCGAATGCGTGCCCTACAACGCGACGTAAAGTCTCGCATCGCCGAAGTCCGAGATGCCAGATGGTCTGATTTCTTAGAAGCACTCGCGCCCTCTCAAAGGTCTTACTACCGCTTAGCTCGTACTCTCAAATCAGATACGGTAGTAACTATGCCCCCCCTCGTAGGCCCTTCAGGCCAACTTGCGGCGTTCGATGATGACGAAAAAGCAGAGCTGCTGGCCGATACATTGCAAATCCAGTGCACGCCCAGCATTCAATCCGCGGACCCTGTTCATGTAGCATTAGTAGACAGTGAGGTAGAACGTAGAGCCTCCTTACCCTCGCACGCGTTACCATCCATCACCCCAATGGAAGTTAAAGACCTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACGGTATATCTAACCGCGTTATTAAACTTCTACCCGTCCAACTCATCGTGATGTTGGCATATATTTTCAATGCCGCTATGGCGAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACACAAACCCGGTAAACCAAAAAATAATCCGACGAGCTACCGCCCAATTAGCCTCCTCATGTCTCTAGGCAAACTGTATGAGCGTCTGCTCTACAAACGCCTCAGAGACTTCGTCTCATCCAAGGGCATACTCATTGATGAACAATTCGGATTCCGTGCAAATCACTCATGGAGCCTCACGGAGCACATTCTTGTAGGGCTTAACCGACCAAAACCAATCTACACGGGAGCCCTCTTCTTCGACGTAGCAAAAGCGTTCGACAAAGTCTGGCACAACGGTTTGATTTTCAAACTATTCAACATGGGCGTGCCGGACAGTCTCGTGCTCATCATACGGGACTTCTTGTCAAACCGCTCTTTTCGATATCGAGTAGAGGGAACCCGCTCCTCCCCGCGTCCACTCACGGCTGGAGTCCCGCAAGGCTCTGTTCACTCTCCGCTCCTATTTAGTTTATTTACTAACGATATTCCCCGGTCGCCGCCGACCCAGCTAGCCTTATTTGCTGACGACACAACAGTTTACTACTCAAGTAGAAATAAGTTCCTAATTGCGAGTAAGCTCCAAAGCGCAGCGTTGACCCTTGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCAGCGAAAAGCACAGCAGTGTTATTTCAAAGGGGAAACTCACCGCTTATTTCCTCCCGCATTAGGAGGAGAAATATCACACCCCCGATCACCCTCTTCGGCCAACCTATACCCTGGGCCAGGAAGGTCAAGTACCTGGGAGTCACCCTGGATGCATCCATGACATTCCGCCCGCATATAAAAACAGTCCGCGATCATGCCGCATTTATTCTCGGCAGACTCTATCCCATGATCTGTAAGCGGAGTAAAATGTCCCTTCGGAACAAGGTGACACTTTACAAAACTTGCATAAGGCCCGTCATGATTTACGCGAGTGTGGTGTTCGCTCACGTGGCCCGCACACACATAGACACCCTCCAATCCCTACAATCCCGCTTTTGA
Protein
MCVCQIHGNVAPIVIASVYLPPDKIVLSSDIEALLSMGSSVILAGDLNCKHIRWNSHTTTPNGRRLDALVDDLTFDIIAPLTPTHYPLNIAHRPDILDIALLKNVALRLHSIEVVSELDSDHRPVVMKLGRAPDSVPVTRTVVDWHTLGISLAESNPPSLPFNPDSTPSPQDTAEAIDILTSHINSTLDRSSKQVVAEDFLHRFKLSDDIRELLRAKNASIRAYDRYPTAENRIRMRALQRDVKSRIAEVRDARWSDFLEALAPSQRSYYRLARTLKSDTVVTMPPLVGPSGQLAAFDDDEKAELLADTLQIQCTPSIQSADPVHVALVDSEVERRASLPSHALPSITPMEVKDLIKDLRPRKAPGSDGISNRVIKLLPVQLIVMLAYIFNAAMANCIFPAVWKEADVIGIHKPGKPKNNPTSYRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRANHSWSLTEHILVGLNRPKPIYTGALFFDVAKAFDKVWHNGLIFKLFNMGVPDSLVLIIRDFLSNRSFRYRVEGTRSSPRPLTAGVPQGSVHSPLLFSLFTNDIPRSPPTQLALFADDTTVYYSSRNKFLIASKLQSAALTLGQWFRKWRIDINPAKSTAVLFQRGNSPLISSRIRRRNITPPITLFGQPIPWARKVKYLGVTLDASMTFRPHIKTVRDHAAFILGRLYPMICKRSKMSLRNKVTLYKTCIRPVMIYASVVFAHVARTHIDTLQSLQSRF

Summary

EMBL
AB018558    BAA76304.1    AB055391    BAB21761.1    U07847    AAA17752.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    GEZM01008457    JAV94772.1    KQ973342    KXZ75569.1    KQ971729    KYB24751.1    GALX01005299    JAB63167.1    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    GBBI01004395    JAC14317.1    GALX01005359    JAB63107.1    ABLF02028535    ABLF02028545    ABLF02034467    ABLF02042518    ABLF02057746    ABLF02008153    ABLF02008462    ABLF02008464    GFTR01008038    JAW08388.1    ABLF02023911    GBBI01004571    JAC14141.1    GGMR01018716    MBY31335.1    GGMS01006359    MBY75562.1    ABLF02041767    NEVH01009134    PNF33528.1    NEVH01011985    PNF31054.1    NEVH01027074    PNF13841.1    S59870    AAB26437.2    NEVH01021205    PNF19912.1    NEVH01006736    PNF36716.1    RPOV01000134    RPJ78669.1    NEVH01022639    PNF18527.1    NEVH01017470    PNF24199.1    GFTR01008262    JAW08164.1    LBMM01013518    KMQ85605.1    GGFJ01001822    MBW50963.1    GEZM01053022    JAV74219.1    GGMR01019198    MBY31817.1    GFTR01008279    JAW08147.1    GGMR01004661    MBY17280.1    ABLF02029306    ABLF02029314    ABLF02060138    KK119261    KFM75202.1    ABLF02024246    GGFL01004957    MBW69135.1    GGMR01000676    MBY13295.1    GFTR01008256    JAW08170.1    GGFL01005012    MBW69190.1    GGMR01003864    MBY16483.1    GFTR01008271    JAW08155.1    KK119692    KFM76444.1    AF456125    AAL57609.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    GBGD01000415    JAC88474.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    ABLF02040174    ABLF02040183    ABLF02055266    ABLF02022418    GECL01003538    JAP02586.1    AY180919    AAN87272.1    GAPW01000276    JAC13322.1    GFTR01008261    JAW08165.1    GGFJ01001858    MBW50999.1    GGFJ01001857    MBW50998.1    GGFL01005121    MBW69299.1    GGFJ01001844    MBW50985.1    GGFL01005122    MBW69300.1    GGFJ01001843    MBW50984.1    GGMR01000226    MBY12845.1    GGFJ01001842    MBW50983.1    GGMR01003407    MBY16026.1    GGFJ01002256    MBW51397.1    NEVH01005277    PNF39135.1    GFTR01008151    JAW08275.1    GGFJ01002257    MBW51398.1    NEVH01016302    PNF25823.1    GGMS01002992    MBY72195.1    GFTR01008251    JAW08175.1    GFDL01000004    JAV35041.1    GBBI01003810    JAC14902.1    GEZM01084969    JAV60363.1    GFDL01000006    JAV35039.1    NEVH01020940    PNF20481.1    NWSH01007753    PCG62823.1    GGMS01017914    MBY87117.1    GFTR01008257    JAW08169.1    NEVH01006754    PNF36554.1    NEVH01019964    PNF22161.1    ABLF02016634    NEVH01014858    PNF27387.1    NEVH01007838    PNF34986.1    NEVH01002716    PNF41415.1    GFTR01008260    JAW08166.1    NEVH01023280    PNF18085.1    M95171    AAA29354.1    NNAY01003095    OXU19992.1    GGMR01013409    MBY26028.1    NEVH01026386    PNF14434.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
PF07727   RVT_2
PF10551   MULE
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR006579   Pre_C2HC_dom       
IPR013103   RVT_2       
IPR013083   Znf_RING/FYVE/PHD       
IPR018289   MULE_transposase_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
743
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
18.99595
Exp number, first 60 AAs:
0.11
Total prob of N-in:
0.05443
outside
1  -  743
 
 

Population Genetic Test Statistics

Pi
117.794472
Theta
15.639793
Tajima's D
0.804679
CLR
0.016009
CSRT
0.616169191540423
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号