SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03427
Pre Gene Modal
BGIBMGA012813
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.263
 

Sequence

CDS
ATGAACTTTGTAACAGTAACTCTTCTTGTTCCAGACAGTAATTATCTCTTAGCGTGTGTAAGAGATGATACAATACAGCTCATAGATCTGCGAATGAACACCATCGTGCGATCGTTCAGTAACGAAGCGTTCAAAGTTGGCTGTGACTGGTCTCGGGCTGCGTTCGGTCCCGGGGGACGTCTGCTGGCGGTTGGAGCCGCGGACGGCGTAGTCTTCGTGTGGAACACGTATTCTGGACGACTTGAAACCACTCTGAAGGATCACACGACGGCGGTGACATCTGTATCGTGGCACCCCCAGTCTGGACTACTGGCCTCAGTGGATCGAGGAAAACGTGCTCTCATATGGGGGGACTTAAGGTATAGAAATTGTATCAAGAAGGCGCAAACCTACCCCGGTGCAGACATTGGGTCAGATCATAACCCAGTGGTGGTAGACGTAGCATGCAAGCTGAAGAAGTTGCAGCCAAAGAGAATGGATCGAAGGCCAAACGTACGGAAGCTTGCTGAGCCCGACACACGAGCGAAGACCCACACCGCTATTAATCAATGGGCCAACGATCGTCGCACTGAAACCACTGCCTCTGACCTCGACACGTGGACTAGTCTAAAGCGAAGTGTAAAAGATATATGTCACCAATACCTCCAACCATCACAACTGGTCAAAAAACAAGATTGGATGACAGATTCAATTTTGCAGCTTATGGAAGACAGGAGGCAATTTAAGGGTACAAATCCAGTAATGTATAAGCAAATCGATGTCACCATTCGAAAAGAGATTGCGAAAGCCAAGAATGATTACTACAGCAATAAGTGCGCGCACTTGGAAGATCTCCTTCGTAAACATGACAGCTTCAATGCGCACAAGCACATCAAGGAAATGGTTGGTCATAGACGGAAATCAATGAATACTCTGACCGATGCAGGTGGGAACCTCATTCTTGACACCGATGGCAAAAAGAGAGTGTGGTGTGACTATGTTGCAGAGATGTTTGCGGACTCATCAAGGAACATTTCACCGATCACTGATCGGACTGGTCCAGCTATGTTGCGATCTGAGGTTTTGCGGGCCTTGAAAGCTGCTAAAACAGGTAAATTACCGGGTCCTGATAATATACCGATCGAAATACTAAAGTTGCTGGAAGAAGATCAACTGGACGTTCTCACACAGTTCTTCAACAACATCTACGAAACAGGCAATCTTCCTAGTGACTGGCTAAAATCCACATTCATCACGATACCCAAGAAGCAAAATGCCAAAAAATGTGGAGAGTATCGTATGATTAGTCTGATGAGCCATGTCCTAAAAGTATTCTTGAACATCATACAGAATAGAATACGGCCAAAATGTGATGAACAACTGGGCGATAGCCAATTTGGATTTCGATCTGGTGTTAGCACCAGAGAAGCTCTTTTCGCTCTCAACGTTCTCGTACAGAAATGCAGAGACATGCAAACTGATGTCTTTTTGTGCTTCATAGACTACGAAAAGGCATTTGACCGAGTTAAACATCATCAACTTTTTAGCCTTTTATGTGATATTGGTCTGGATGGTAAGGACGTCAGAATCATCCGCAACCTGTACGAGAAGCAGGTGGCTACGATAAGAGTCGAAAATGAGGAAACCGACCAAGTTGAGATCTGTCGTGCGGTCCGGCAGGGGATGAACATTTGGCTAAAGGATAAGAAGATAAGGAAAATAATTTAA
Protein
MNFVTVTLLVPDSNYLLACVRDDTIQLIDLRMNTIVRSFSNEAFKVGCDWSRAAFGPGGRLLAVGAADGVVFVWNTYSGRLETTLKDHTTAVTSVSWHPQSGLLASVDRGKRALIWGDLRYRNCIKKAQTYPGADIGSDHNPVVVDVACKLKKLQPKRMDRRPNVRKLAEPDTRAKTHTAINQWANDRRTETTASDLDTWTSLKRSVKDICHQYLQPSQLVKKQDWMTDSILQLMEDRRQFKGTNPVMYKQIDVTIRKEIAKAKNDYYSNKCAHLEDLLRKHDSFNAHKHIKEMVGHRRKSMNTLTDAGGNLILDTDGKKRVWCDYVAEMFADSSRNISPITDRTGPAMLRSEVLRALKAAKTGKLPGPDNIPIEILKLLEEDQLDVLTQFFNNIYETGNLPSDWLKSTFITIPKKQNAKKCGEYRMISLMSHVLKVFLNIIQNRIRPKCDEQLGDSQFGFRSGVSTREALFALNVLVQKCRDMQTDVFLCFIDYEKAFDRVKHHQLFSLLCDIGLDGKDVRIIRNLYEKQVATIRVENEETDQVEICRAVRQGMNIWLKDKKIRKII

Summary

EMBL
GU815089    ADF18552.1    NWSH01001998    PCG69477.1    HACG01048870    CEK95735.1    + More
HACG01048883    CEK95748.1    QIAP01000240    PYX61602.1    HACG01048876    CEK95741.1    HACG01048875    CEK95740.1    HACG01048879    CEK95744.1    HACG01048873    CEK95738.1    GFAH01000222    JAV48167.1    KL367526    KFD66335.1    KF881087    AIJ27486.1    NEVH01016127    PNF26367.1    NEVH01026403    PNF14170.1    NEVH01020868    PNF20797.1    KN538403    KHJ42451.1    NEVH01012087    PNF30599.1    KF881086    AIJ27485.1    GBBM01003639    JAC31779.1    NEVH01023960    PNF17698.1    NEVH01017478    PNF24170.1    NEVH01013243    PNF29503.1    NEVH01002700    PNF41535.1    NEVH01017443    PNF24485.1    NEVH01027067    PNF13944.1    NEVH01021610    PNF19569.1    NEVH01019066    PNF23173.1    NEVH01020333    PNF21790.1    NEVH01000609    PNF43402.1    NEVH01023953    PNF17877.1    NEVH01025668    PNF15041.1    NEVH01012564    PNF30212.1    NEVH01005896    PNF38212.1    NEVH01016289    PNF26277.1    NEVH01011205    PNF31711.1    NEVH01013215    PNF29703.1    NEVH01020851    NEVH01013954    NEVH01006574    NEVH01001358    NEVH01001354    PNF21237.1    PNF28332.1    PNF37782.1    PNF42792.1    PNF42884.1    NEVH01027104    PNF13657.1    NEVH01021928    PNF19298.1    NEVH01017460    PNF24248.1    NEVH01026085    PNF14968.1    NEVH01017540    PNF24056.1    PNF38208.1    NEVH01011186    PNF32183.1    NEVH01016335    NEVH01006721    PNF25462.1    PNF37115.1    PNF37211.1    NEVH01013959    PNF28275.1    NEVH01003500    PNF40666.1    NEVH01021921    PNF19488.1    NEVH01013553    PNF28765.1    NEVH01012082    PNF31006.1    PNF37310.1    NEVH01005277    PNF39212.1    NEVH01015309    PNF27009.1    NEVH01021219    PNF19787.1    NEVH01020937    PNF20581.1    NEVH01021931    PNF19256.1    NEVH01020940    PNF20478.1    NEVH01017452    PNF24293.1    NEVH01023985    PNF17546.1    NEVH01002141    PNF42599.1    NEVH01002982    PNF41147.1    NEVH01002684    PNF41704.1    NEVH01017534    PNF24114.1    NEVH01022640    NEVH01008218    NEVH01005885    PNF18513.1    PNF34430.1    PNF38481.1    NEVH01003750    PNF40091.1    NEVH01014359    PNF27813.1    NEVH01020865    PNF20863.1    NEVH01019075    PNF22955.1    NEVH01010501    PNF17732.1    PNF32290.1    NEVH01014358    PNF27914.1    NEVH01007402    PNF35815.1    NEVH01017570    PNF23798.1    NEVH01019971    PNF22037.1    NEVH01019064    PNF23230.1    NEVH01013275    PNF29009.1    NEVH01025135    PNF15828.1    NEVH01018372    NEVH01014371    NEVH01011208    NEVH01002697    NEVH01002552    PNF23678.1    PNF27673.1    PNF31697.1    PNF41592.1    PNF42118.1    PNF27789.1    GGMR01018096    MBY30715.1    NWSH01000469    PCG76200.1    ABLF02013955    GDHC01007098    GDHC01001590    JAQ11531.1    JAQ17039.1    NEVH01025130    PNF15934.1    NEVH01018380    PNF23492.1    NEVH01006734    PNF36732.1    FJ265560    ADI61828.1    NEVH01007824    PNF35184.1    AAGJ04118689    AAGJ04161747    FJ265552    ADI61820.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF03372   Exo_endo_phos
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR027124   Swc5/CFDP2       
IPR000637   HMGI/Y_DNA-bd_CS       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
5NUV     E-value=1.92951e-23,     Score=272

Ontologies

Topology

Length:
568
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.07343
Exp number, first 60 AAs:
0.01194
Total prob of N-in:
0.00321
outside
1  -  568
 
 

Population Genetic Test Statistics

Pi
298.1491
Theta
192.016051
Tajima's D
0.581978
CLR
1.032024
CSRT
0.538023098845058
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号