SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03416
Annotation
PREDICTED:_RNA-directed_DNA_polymerase_from_mobile_element_jockey-like_[Plutella_xylostella]
Location in the cell
Cytoplasmic   Reliability : 1.479 Mitochondrial   Reliability : 1.137 Nuclear   Reliability : 1.759
 

Sequence

CDS
ATGGTGGAGGTTGGTACTAGGGAAAATATAATGACGATACGAGTTGGCGCTACTCTTACTGATGAGTTTGACGTTGTGACTGGACTCAGGCAAGGGGACGCTCTGTCACCAATGCTGTTCAACCAAGCACTTGAACACGTCATACGGAAAGTGAACACATATAATGGCGGAGTGTGGCTTAATGGACAGCATAAGGTGATAGGGTATGCCGATGAGCTTGTTCTACTAGGAGAAAGAAAGCAGCACGTTATAGACGCATTCAACTGCTTCCAACAAGAAGCCTCTTGGATTGGCCTTCGTGTGAGCCACGACAAGACAGAGTATCTTCACATTTGTCGACACAAAAACATAAGACGGAAGCGAGAAGACTTAGTTGTGGGAAATACGAGATACAAAGGGGTGGCCAAATTCCAGTTCGTTGGCTGCATTGTAAAAGACACCAATGACAAGGAAGACGAGATCGAAATACGTGTACAAAATACCCTACAATGCAGTGCAGCCCTGCATCCGGTCCTCTCTTCGAAGTTACTAAGCAGGCGTACTAAGGTTCGGATATACAAGACTATAGTCAGACCGATCTTATTGTATGGATGCGAAGCATGGACGCTTACACAAAAAGAAGAGACAAAACTTCTCGTGACGGAGCGAAAGATACTGAGAAAGATCCGGATAGCACATCCGGAAAAACAAGGACGTGGAGAGGCTTTTTGA
Protein
MVEVGTRENIMTIRVGATLTDEFDVVTGLRQGDALSPMLFNQALEHVIRKVNTYNGGVWLNGQHKVIGYADELVLLGERKQHVIDAFNCFQQEASWIGLRVSHDKTEYLHICRHKNIRRKREDLVVGNTRYKGVAKFQFVGCIVKDTNDKEDEIEIRVQNTLQCSAALHPVLSSKLLSRRTKVRIYKTIVRPILLYGCEAWTLTQKEETKLLVTERKILRKIRIAHPEKQGRGEAF

Summary

EMBL
GECZ01011079    JAS58690.1    AJVK01001578    GGMS01002991    MBY72194.1    NEVH01019065    + More
PNF23216.1    PYGN01000510    PSN45119.1    GGMR01000301    MBY12920.1    GGMR01020071    MBY32690.1    PYGN01000078    PSN55011.1    GECU01026439    JAS81267.1    GGMR01016675    MBY29294.1    CH902961    KPU72636.1    ABLF02059747    RAPH01000014    RNL66055.1    ABLF02031649    GECU01011157    JAS96549.1    CH902619    KPU76535.1    CH904714    KPU81814.1    ABLF02005298    ABLF02018860    GGMS01011865    MBY81068.1    ABLF02026145    ABLF02026146    ABLF02042729    PYGN01000082    PSN54842.1    CH905131    KPU81852.1    ABLF02010115    ABLF02030763    ABLF02034262    CH902657    KPU75308.1    PYGN01000064    PSN55609.1    QOUI01000020    RCK67885.1    PYGN01000502    PSN45243.1    CH902653    KPU74858.1    CH902626    KPU79149.1    PYGN01000372    PSN47498.1    PYGN01000451    PSN46127.1    RAPH01000016    RNL65702.1    GGMR01000126    MBY12745.1    PYGN01000107    PSN54137.1    GGMS01017110    MBY86313.1    CH902621    KPU81727.1    GGMR01014652    MBY27271.1    PYGN01000580    PSN43876.1    PYGN01000287    PSN49259.1    GBGD01000331    JAC88558.1    PYGN01000070    PSN55417.1    HE799691    CCH14900.1    ABLF02003877    ABLF02042991    ABLF02020712    ABLF02020717    ABLF02054820    ABLF02027703    ABLF02061609    ABLF02022322    ABLF02022323    PYGN01000047    PSN56294.1    GBRD01000202    JAG65619.1    PYGN01001004    PSN38555.1    GGMR01006433    MBY19052.1    PYGN01000324    PSN48495.1    PYGN01000020    PSN57453.1    PYGN01000203    PSN51319.1    ABLF02002110    ABLF02018097    ABLF02043469    ABLF02056908    GGMR01011466    MBY24085.1    PYGN01000219    PSN50892.1    PYGN01000274    PSN49532.1    ABLF02032855    ABLF02009557    ABLF02016497    ABLF02041313    ABLF02041567    ABLF02062088    PYGN01000629    PSN43121.1    GBBI01004263    JAC14449.1    ABLF02065752    GBBI01004199    JAC14513.1    GBHO01016952    JAG26652.1    GBRD01017846    JAG47981.1    ABLF02039015    AAZX01023614    ABLF02002294    ABLF02066124    PYGN01001382    PSN35227.1    ABLF02019049    ABLF02067155    ABLF02018925    PYGN01003402    PSN29545.1    ABLF02011153    ABLF02057094    ABLF02063363    ABLF02036907    ABLF02036915    ABLF02036922    ABLF02041419    GBXI01013084    JAD01208.1    ABLF02037000    ABLF02003651    ABLF02007294    ABLF02007295    ABLF02056183    ABLF02016112    GBHO01006441    JAG37163.1    PYGN01000836    PSN40188.1    GBBI01004198    JAC14514.1    PYGN01001494    PSN34463.1    ABLF02009558    ABLF02057180    GDHC01021627    JAP97001.1    ABLF02016676    PYGN01000577    PSN43959.1    GDAI01000742    JAI16861.1    GBRD01011073    JAG54751.1    ABLF02022061    ABLF02019047    GGMS01005820    MBY75023.1    ABLF02036816    GGMR01010991    MBY23610.1    ABLF02042851    GECL01002632    JAP03492.1    KU311054    ALX81665.1   
Pfam
PF00078   RVT_1        + More
PF03372   Exo_endo_phos
PF14529   Exo_endo_phos_2
PF05699   Dimer_Tnp_hAT
PF13359   DDE_Tnp_4
PF17919   RT_RNaseH_2
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR012337   RNaseH-like_sf       
IPR008906   HATC_C_dom       
IPR000637   HMGI/Y_DNA-bd_CS       
IPR027806   HARBI1_dom       
IPR041577   RT_RNaseH_2       
SUPFAM
SSF56219   SSF56219        + More
SSF53098   SSF53098       
Gene 3D

Ontologies

Topology

Length:
236
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.03147
Exp number, first 60 AAs:
0.00209
Total prob of N-in:
0.08689
outside
1  -  236
 
 

Population Genetic Test Statistics

Pi
195.899717
Theta
136.639211
Tajima's D
1.362659
CLR
0.182843
CSRT
0.757162141892905
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号