SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03410
Annotation
hypothetical_protein_TcasGA2_TC031727_[Tribolium_castaneum]
Location in the cell
Nuclear   Reliability : 2.231
 

Sequence

CDS
ATGGTTTTTACGATAAAATTTTTATCCCTACAAAAAACTGAACTGGAATACGAAGTCGCGATAAGAGGTGAGACCCCCGGTGCTACGGTGGCTGATCTTAGGAAACAGATTAGCAAATTAAGTCAATCTTTTCCTTCAGAAGATGTATTATGTTCTCATCTCGAACCCCTAGATGATCTTCAAGCTGTTTTGGACTTGCTGAATAAAGTCAATGCAAGTCTCGAGTCAAGCCCTACTGATAAAAGTACATTATCGCGCATAGAAAATATTTTTCATCACCTTTATCATAGGATCAACAGAATAGTGGTTGATGAAGTAGAGAAGCCGCACTCTGCTTGTAGTAAACTTTTTAAAGAATTCTACGAAAAATTCCAGAAATTAAGCAAAAAGGCAATTGATCCTCTATTAGTTGGTGTATCTAGTTCAGCATCTGCTTCTGTACCTGGCATTCAGGCACCAATTAATGTCGCTGTTACTTGTGATAGAGGTGTTACTTCAGAACTGAGTAGGCTGAAGTTCGATGGTAAGTCATGTGTTCGATCTTTTATTCAACGTGTTTACGAATTTAGCGAGGCGCGTAGCATCCCCGACTCAAAACTTCTCTCATCTGCTACAGAAATATTTACAGATGATGCGCTGCATTGGTTCAGGAGTATTAAGGACCAGGTTTCATCTTGGGATGATCTTGTTATTCTTTTAAAAAAAGATTTTGATAAAGCAGACTATGATTACCGTTTACTTGCTGAGATTCGTGCTAGGACTCAAGGGGAAACGGAAAATATTACGATCTACTTAGCTATTCTCTCGGATGTTGGTAGCCCAACCAATTTTTTGCGCTCGTATGATTATTTGGACGAATCACAAAAGGCCGTCGTTGACAATATTACTAAGCAGTTTGAAGAAATATCTTTTGAGCGCAAAGGACTTGGACGCACAAACTTAATTACTCACCACATTGACACGGGGAATTCTCCTCCTGTGAGACAGCGCTACTATAGGCTTTCACCAGAGAAACAGAGAATCCTAGTCGAGCAAGTAGACGAAATGCTCCAGCTTGATGTAGTTGAGCCTTGTGAGAGTGCCTGGCAATCCCCGGTATTGCTAGTCACTAAAAAAGATGGTCAGCCGCGGTTCTGCTTAGATAGTAGGAAGCTAAACTCTGTTACAAAACGCGACGCTTATAACTTACCTTACATATCGGAGATATTGGACAACTTGCGAGACGCGCGCTATCTTAGCAGTATTGACTTATCAAAGGCTTTCTGGCAATTACCAATAGCACTCGAAGATAGGGACAAGACGGCATTTTACGTTCCGGGACGAGGGACGTTACGGTTCAAGACTACACCGTTTGGTTTGACCAATGCGCCTTCTACGCAACAGCGGTTAGTCGATTTATTGTTTGGCGACATGGATCACAAGGCGTTCGCATATTTAGATGATGTGATAATAGTAAGTAGCACGTTTGATGAGCATGTTAGTCTTCTTCTTCGCGTGTTAGACAAGCTGCGCCATGCTAATCTAACAATTAATTTAGAAAAGTGTGAATTTTTTCGAAGTAAACTTAAATATTTAGGCTATGTGGTCGACGCGAATGGTTTGCGGACTGATCCGGATAAAGTTACAGCCATTCTAAATTACCCAACTCCTACATGTCGTAAGGACTTGAAACGGTTCCTAGGCACGGCAACATGGTACCGGAGATTTGTCCCAAACTTTAGCACTATCGCAGGGCCGCTTAATAGGTTGACATCGAACAAAAAATCAACACCTCCCTTCCAGTGGACAGATGAGGCCGACACTGCGTTCAAAAAACTTAAGGAATCTTTGGTCTCTGCACCTGTTCTCTCCTGCCCAAATTACGATCTGCCTTTCGAAGTCCATACAGATGCTAGTAACTATGGGATAGGTGGTATGCTCACACAAACTATTGACGGGAAAGAGCACCCTATAGCGTATATGAGCAAGTCCTTATCGGGGGCCGAAAAGAATTATAGCATTACCGAACGTGAGACCTTAGCTGTTCTCGTGGCTCTCGAGCACTGGCGTTGCTATCTGGAGAACGGAAAGACATTCACGGTTTACACAGACCACAGCGCACTTAAGTGGTTCCTTTCCTTGAACAATCCTACGGGTAGGCTTGCACGTTGGGGAGTTCGATTATCGTCGTTTGATTTTGAAATCAAACACCGCCGCGGTGTAGACAATGTGATTCCCGACGCTTTGTCTAGAGCTGTCCCGGTCAATACTATCACTACTGCTAAATCACTCACGACTTCTAGTGATGATTGAGTTTAA
Protein
MVFTIKFLSLQKTELEYEVAIRGETPGATVADLRKQISKLSQSFPSEDVLCSHLEPLDDLQAVLDLLNKVNASLESSPTDKSTLSRIENIFHHLYHRINRIVVDEVEKPHSACSKLFKEFYEKFQKLSKKAIDPLLVGVSSSASASVPGIQAPINVAVTCDRGVTSELSRLKFDGKSCVRSFIQRVYEFSEARSIPDSKLLSSATEIFTDDALHWFRSIKDQVSSWDDLVILLKKDFDKADYDYRLLAEIRARTQGETENITIYLAILSDVGSPTNFLRSYDYLDESQKAVVDNITKQFEEISFERKGLGRTNLITHHIDTGNSPPVRQRYYRLSPEKQRILVEQVDEMLQLDVVEPCESAWQSPVLLVTKKDGQPRFCLDSRKLNSVTKRDAYNLPYISEILDNLRDARYLSSIDLSKAFWQLPIALEDRDKTAFYVPGRGTLRFKTTPFGLTNAPSTQQRLVDLLFGDMDHKAFAYLDDVIIVSSTFDEHVSLLLRVLDKLRHANLTINLEKCEFFRSKLKYLGYVVDANGLRTDPDKVTAILNYPTPTCRKDLKRFLGTATWYRRFVPNFSTIAGPLNRLTSNKKSTPPFQWTDEADTAFKKLKESLVSAPVLSCPNYDLPFEVHTDASNYGIGGMLTQTIDGKEHPIAYMSKSLSGAEKNYSITERETLAVLVALEHWRCYLENGKTFTVYTDHSALKWFLSLNNPTGRLARWGVRLSSFDFEIKHRRGVDNVIPDALSRAVPVNTITTAKSLTTSSDDXV

Summary

Pfam
PF17917   RT_RNaseH        + More
PF00078   RVT_1
PF17919   RT_RNaseH_2
PF03732   Retrotrans_gag
PF12017   Tnp_P_element
Interpro
IPR000477   RT_dom        + More
IPR041373   RT_RNaseH       
IPR005162   Retrotrans_gag_dom       
IPR021896   Transposase_37       
IPR041577   RT_RNaseH_2       
ProteinModelPortal
PDB
4OL8     E-value=1.12553e-71,     Score=689

Ontologies

Topology

Length:
765
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00186
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00007
outside
1  -  765
 
 

Population Genetic Test Statistics

Pi
406.198067
Theta
209.357592
Tajima's D
2.779256
CLR
0.55078
CSRT
0.967251637418129
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号