SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03395
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.852 Nuclear   Reliability : 1.344
 

Sequence

CDS
ATGATTGCACACTGCAGAACCAGGCCCCTAGTCCCCGGCGGCCCCGCTATTTCTGGTTACGGTAGCGGCCATGGTAACGGCGGGGCAAGGGGTGCTAAGAATCCCCGGCAGAGATCCGGCTACCACCCCCCTTCACAACGACAACTGGCCCTGGTGACATACAACGTGCGCACTTTGAGGTTGGACGAGAAGCTAATAGAGCTGGAAGAAGAAATGAACAAGTTGCGCTGGGACGTTATTGGTTTATCGGAGATCCGAAGAGAGGGGGAGGATACGAAAACCTTACAGTCCGGCCACTTGTTCTACTACCGGGAGGGAGAACAGAAGTCCCAAGGTGGTGTTGGGTTTATCGTCCACAAATCTCTCATAAACAACATTGTGGCCATCGAAAGTGTGTCGAGTAGGGTAGTATACCTTGTCCTCAAAATCTCAAAGCGGTATTCGCTGAAGATTGTACAGGTATACGCCCCATCGACGTCACATCCAGACGATGAAGTGGAAGCTACGTATGAGGACATTAGTAGGGCCATACGTAACTCCCAATCACATTTTACCGTTGTTACGGGAGATTTCAATGCAAAACTGGGCCGTAGATGCGATGATGAGTTGAAAGTGGGGCCATTTGGATTTGGGCAGCGGAATCCCAGAGGACAGATGCTGGTGGACTTTATGGAGAAGGAAGGACTCTTTATGATGAATTCTTTCTTCAAGAAGCCGCCACAATGGAAATGGACCTGGTTGAGTCCCGACGGTGTAACAAGAAATGAAATTGACTTCATCATGAGCGCCAACAGACAGATATTCAACGATGTCTCTGTGATCAACAGTGTTAAAACAGGAAGTGATCACCGAATCGTCAGAGGCATGTTGAATATCAATCGTATCAAAGAGACGATTGAGCGAAACCAAGGCTCTAAAGTGTTCGCAAGAGACGCTTCTATTGGGCAAAGCCAGCTGACGAAGCTGAAGACCGAAGATGGACGTGTAACGTCGAATAAGCCAGAGGTCCTGCGGGAGATAGAGAGGTTCTACGGGCAGCTGTTTACCTCGGTCTCAGCTGAACCGCAAGGTTTAGCTGCAGACCCTAGAGCCAAGCTAACCCGACACTACACCGAAGACATCCCGGAAATCAGCCTGTACGAGATTAGGATGGCTCTCAAACAGCTTAAGAATAACAAGGCACCGGGCGAGGATGGAATTACTACGGAGCTTCTGAAAGCGGGCGGGACGCCGGTACTGAAAGTCCTTCAGAAGCTCTTCAATTCCTCTTTGCTCGATGGAAAACCGCCACAGGCATGGAACAGGGGTGTTGTGATCCTGTTCTTCAAAAAAGGTGACAAAACCTTATTGAAGAACTATAGGCCCATAGCACTGCTGAGCCATGTCTACAAGTTGTTCTCGAGAGTCATCACGAAGCGTCTCGAACGCAGGTTTGATGACTTCCAGCCTACCGAACAAGCCGGTTTCCGAAAAGGCTACAGTACCATAGACCACATACATACGCTGCGGCAGATTGTACAGAAGACCGAAGAGTACAATCGGCCATTATGCTTAGCGTTTGTGGACTATGAGAAAGCCTTTGATTCCATCGAAACATGGGCGGTCCTTAGATCTCTCCAGCGGTGCCGTATTGACCACCGGTACATCGAAGTATTGAAGTGTTTGTATAATAACGCCACCATGTCAATCCGAGTACAGGAGCTTTGCACGAAGGAAATCCCTGTAAAGAGAGGAGTGAGACAGGGAGATGTGATATCTCCGAAACTGTTTATCACTGCTCTGGAGGATTCCTTCAAGCTTCTGGAATGGCAAGGACTTGGCATCAATATTAACGGCGAATACATCACTCATCTTCGGTTTGCCGATGACATCGTGATCATGGCAGAGTCGCTGGAAGATTTAGGGCGTATGCTCGGTGACCTCAGTAGGGTTTCTCAACAAGTGGGTCTTACAATGAACATGGACAAAACAAAAATCATGTACAATGTCCATGTTGCACCCACCATAGTTACTGTTGGGAGCTCTACTCTTGAAGTTGTTGACGAATATATATACCTAGGACAGGCAGTCCGATTAGGTAGGTCCAACTTTGAGAGAGAGGTCAGTAGACGGATCCAACTCGGATGGGCAGCGTTCGGTAAACTGCACAACGTCTTCTCGTCCAAAATACCTCAGTGCCTTAAGACAAAGGCGTACAACCAATGTGTGTTACCAGTGATGACGTACGGCTCGGAGACGTGGTGCTTCACTAGGGATCTTTTTAGAAGGCTCAAAGTCGCGCAGCGAGCTATGGAGAGGGCTATGCTCGGCATTTCTCTACGTGATCGAATCCGAAATGAGGAGATCCGTAGAAGAACGAAGGTTGCTGACATAGCTCGTAGAATTAGTGAACTAAAGTGGCAATGGGCCGGCCACATAGCACGAAGAGAGGACGGTCGATGGGGCAGAAAGATCCTGGAGTGGCGACCACGTACTGGCAAGCGCAGTGTGGGACGGCCACCTACTAGATGGACCGACGACCTAGTAAAAAGCGCTGGGTATCGTTGGATGCAGGTGGCAATGGACCGGTCGCACTGGAAATCTATTGGAGAGGACTATGTTCAGCAGTGGACGGCGATAGGCTGA
Protein
MIAHCRTRPLVPGGPAISGYGSGHGNGGARGAKNPRQRSGYHPPSQRQLALVTYNVRTLRLDEKLIELEEEMNKLRWDVIGLSEIRREGEDTKTLQSGHLFYYREGEQKSQGGVGFIVHKSLINNIVAIESVSSRVVYLVLKISKRYSLKIVQVYAPSTSHPDDEVEATYEDISRAIRNSQSHFTVVTGDFNAKLGRRCDDELKVGPFGFGQRNPRGQMLVDFMEKEGLFMMNSFFKKPPQWKWTWLSPDGVTRNEIDFIMSANRQIFNDVSVINSVKTGSDHRIVRGMLNINRIKETIERNQGSKVFARDASIGQSQLTKLKTEDGRVTSNKPEVLREIERFYGQLFTSVSAEPQGLAADPRAKLTRHYTEDIPEISLYEIRMALKQLKNNKAPGEDGITTELLKAGGTPVLKVLQKLFNSSLLDGKPPQAWNRGVVILFFKKGDKTLLKNYRPIALLSHVYKLFSRVITKRLERRFDDFQPTEQAGFRKGYSTIDHIHTLRQIVQKTEEYNRPLCLAFVDYEKAFDSIETWAVLRSLQRCRIDHRYIEVLKCLYNNATMSIRVQELCTKEIPVKRGVRQGDVISPKLFITALEDSFKLLEWQGLGININGEYITHLRFADDIVIMAESLEDLGRMLGDLSRVSQQVGLTMNMDKTKIMYNVHVAPTIVTVGSSTLEVVDEYIYLGQAVRLGRSNFEREVSRRIQLGWAAFGKLHNVFSSKIPQCLKTKAYNQCVLPVMTYGSETWCFTRDLFRRLKVAQRAMERAMLGISLRDRIRNEEIRRRTKVADIARRISELKWQWAGHIARREDGRWGRKILEWRPRTGKRSVGRPPTRWTDDLVKSAGYRWMQVAMDRSHWKSIGEDYVQQWTAIG

Summary

Pfam
PF00078   RVT_1
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
6AR3     E-value=9.83654e-06,     Score=121

Ontologies

Topology

Length:
874
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.03043
Exp number, first 60 AAs:
0.00286
Total prob of N-in:
0.00124
outside
1  -  874
 
 

Population Genetic Test Statistics

Pi
541.246643
Theta
214.878984
Tajima's D
4.503548
CLR
0.526047
CSRT
0.99990000499975
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号