SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03388
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.282 Nuclear   Reliability : 1.076
 

Sequence

CDS
ATGAAGCTCGGTCGCGCTCCCGATTCCGTTCCCGTCACGAGGACTGTGGTGGATTGGCACACGCTGGGCATCAGCCTGGCTGAATCTGATCCACCATCGCTCCCGTTTAACCCGGACTCTATCCCGTCTCCTCAGGATACCGCTGAAGCCATAGACATCTTAACGTCACACATCACCTCGACATTAGATAGGTCATCGAAACAAGTTGTAGCGGAGGACTTCCTTCACCGCTTCAAATTGTCCGACGATATTAGGGAACTCCTTAGAGCTAAGAACGCCTCGATACGCGCCTACGACAGGTATCCTACCGCGGAAAATCGTATTCGAATGCGTGCCCTACAACGCGACGTAAAGTCTCGCATCGCCGAAGTCCGAGATGCCAGATGGTCTGATTTCTTAGAAGGACTCGCGCCCTCCCAAAGGTCTTACTACCGCTTAGCTCGTACTCTCAAATCGGATACGGTAGTAACTATGCCCCCCCTCGTAGGCCCCTCAGGCCGACTCGCGGCGTTCGATGATGACGAAAAAGCAGAGCTGCTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCACTCAATCCGTGGACCCTGTTCATGTAGAATTAGTAGACAGTGAGGTAGAACGCAGAGCCTCCTTGCCACCATCGGATGCGTTACCACCCGTCACCCCGATAGAAGTTAAAGACTTGATCAAAGACCTACGTCCTCGCAAGGCTTCCGGTTCCGACGGTATATCTAACCGCGTTATTAAACTTCTACCCGTCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCGAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACATAAACCCGGTAAACCAAAAAATCATTCGACGAGCTACCGCCCTATTAGCCTCCTCATGTCTCTAGGCAAACTGTATGAGCGTCTGCTCTACAAACGCCTCAGAGACTTCGTCTCATCCAAGGGCATTCTCATCGATGAACAATTCGGATTCCGTACAAATCACTCATGCGTTCAACAGGTGCACCGCCTCACGGAGCACATTCTTGTGGGGCTTAATCGACCAAAACCGTTATACACGGGAGCTCTCTTCTTCGACGTCGCAAAAGCGTTCGACAAAGTCTGGCACAATGGTTTGATTTTCAAACTATTCAACATGGGCGTGCCGGATAGTCTCGTGCTCATCATACGGGACTTCTTATCGAACCGCTCTTTTCGATATCGAGTCGAGGGAACCCGCTCCTCCCCACGACCTCTCACAGCTGGAGTCCCGCAAGGCTCTGTCCTTTCACCCCTCCTATTTAGCTTATTCGTCAACGATATTCCCCGGTCGCCGCCGACCCATTTAGCTTTATTCGCCGACGACACGACTGTTTACTATTCTAGTAGAAATAAGTCCCTAATCGCGAAGAAGCTTCAGAGCGCAGCCCTAGCCCTAGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCAGCGAAATAG
Protein
MKLGRAPDSVPVTRTVVDWHTLGISLAESDPPSLPFNPDSIPSPQDTAEAIDILTSHITSTLDRSSKQVVAEDFLHRFKLSDDIRELLRAKNASIRAYDRYPTAENRIRMRALQRDVKSRIAEVRDARWSDFLEGLAPSQRSYYRLARTLKSDTVVTMPPLVGPSGRLAAFDDDEKAELLADTLQTQCTPSTQSVDPVHVELVDSEVERRASLPPSDALPPVTPIEVKDLIKDLRPRKASGSDGISNRVIKLLPVQLIVMLASIFNAAMANCIFPAVWKEADVIGIHKPGKPKNHSTSYRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRTNHSCVQQVHRLTEHILVGLNRPKPLYTGALFFDVAKAFDKVWHNGLIFKLFNMGVPDSLVLIIRDFLSNRSFRYRVEGTRSSPRPLTAGVPQGSVLSPLLFSLFVNDIPRSPPTHLALFADDTTVYYSSRNKSLIAKKLQSAALALGQWFRKWRIDINPAK

Summary

EMBL
U07847    AAA17752.1    AB018558    BAA76304.1    AB055391    BAB21761.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    GEZM01008457    JAV94772.1    KQ973342    KXZ75569.1    KQ971729    KYB24751.1    KQ973412    EFA12510.2    GALX01005299    JAB63167.1    GGMS01002955    MBY72158.1    GGMS01006359    MBY75562.1    GGMR01019198    MBY31817.1    GALX01005359    JAB63107.1    GFXV01007093    MBW18898.1    GBYB01008290    JAG78057.1    ABLF02029306    ABLF02029314    ABLF02060138    GECU01013097    JAS94609.1    RPOV01000134    RPJ78669.1    ABLF02028535    ABLF02028545    ABLF02016634    ABLF02040174    ABLF02040183    ABLF02055266    GFTR01008038    JAW08388.1    GBBI01004395    JAC14317.1    ABLF02042518    ABLF02057746    GGMS01000625    MBY69828.1    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    GGMS01017914    MBY87117.1    GGMR01018716    MBY31335.1    S59870    AAB26437.2    GGMS01017365    MBY86568.1    NEVH01010546    PNF32261.1    NEVH01019080    PNF22876.1    ABLF02021177    ABLF02027367    ABLF02066338    ABLF02008463    GGMR01014053    MBY26672.1    ABLF02033757    ABLF02040650    ABLF02040651    ABLF02056776    ABLF02034467    NEVH01006736    PNF36716.1    NEVH01001355    PNF42855.1    GGMR01003407    MBY16026.1    ABLF02041767    NEVH01014858    PNF27387.1    NEVH01002716    PNF41415.1    NEVH01007838    PNF34986.1    GGMR01004661    MBY17280.1    NEVH01021205    PNF19912.1    NEVH01000280    PNF43672.1    ABLF02008153    ABLF02008462    ABLF02008464    NEVH01005277    PNF39135.1    NEVH01019964    PNF22161.1    GGMR01013409    MBY26028.1    NNAY01003095    OXU19992.1    KK118005    KFM71947.1    L79944    AAB04627.1    NEVH01006754    PNF36554.1    GFTR01008262    JAW08164.1    NEVH01011985    PNF31054.1    GBBI01001699    JAC17013.1    NEVH01009134    PNF33528.1    NEVH01027074    PNF13841.1    GGMR01015412    MBY28031.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
PF10551   MULE
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
IPR013083   Znf_RING/FYVE/PHD       
IPR018289   MULE_transposase_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
500
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
5.04051
Exp number, first 60 AAs:
0
Total prob of N-in:
0.04468
outside
1  -  500
 
 

Population Genetic Test Statistics

Pi
0.173544
Theta
0.160893
Tajima's D
0
CLR
135.165055
CSRT
0.227038648067597
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号