SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03380
Pre Gene Modal
BGIBMGA010702
Annotation
PREDICTED:_uncharacterized_protein_LOC105842267_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 4.228
 

Sequence

CDS
ATGCCTCGAAAATATATAAGGAAATGTCCCGATCGGAAAGTCTGTACTCAAGAGCAAATTGATAAAGCCAAGCAGTTGATTGGAGAAGGAAAATCGAAACGAGCAGCAGCAGAAATTGTTGGGATCAATGAGAGTACTTTGAGAAAACGTTTAAAACTCAACTCCACTGCAACATCAATGGGGAGATATCAACAAACATTTACACGTGAACAAGAGGAAGAAATTTACAATCATTGCAAATCTAGTGACGAGAGGTTCTACGGTCTTACTTTGAATACACTGAGAAAATTAGTTTACGAATTTGCAGAAGTGAATGAAATAGAGAATAGGTTTGATAAAACAACAAAAATGGCTGGAAAAGACTGGGTCTACGAGTTTATAAAACGACATCCTGATTTAGCTTTAAAGCAAACTACACCTACGAGCATTGCAAGAGCCATTGGTTTTAATCAAGTGCAAGTAAATAGATTTTATACAAACTTGAAAAAGTGTCAAGAAAAATATAACTTCCCTCCAGGTCGAATATATAATATGGACGAGACTGGCATCAGCACAGTGCCAAAAAAGACTCCTAAAGTTATATCACTGAAAGGAAAAAAAAATGTTAATAAAATTGTTTCTGGAGAACGTGGTCAAACTATAACTGCTGTTTGCTGTGTCAGTGCAACTGGAAATTATGTGCCTCCTCCATTTATATTTCCTCGAAAAAGGATGAAGGGTGAACTCATGGATGGAGCTCCAACTGGAAGTATTGGTATGACATCTGATTCGGGATTTATCAACACGGATTTATATTTGGAATGGCTTCATCATTTCAAGGACTACACTTCACCAACTGTCGATAATCCTGTGCTACTGATTATTGACAATCATTCAAGCCATATTAGCTTGCAAGGTACCTTGTATTGCAGACAGCATAACATCATAGTACTTACTTTGCCACCTCACAGCAGTCACAAATTACAACCCTTGGATAGGGCTATTTACAGTCCTCTTAAAAGCCAGTACGCAATTAAAGCTGATAAATGGATGGCACAGCATCCTGGTAGATCTATTAATCAATACCAAGTGACTTTGATTTTTAACAGAGCCTTTCTAAAAATTGCCACTGTGGGTAACGCAGCTTCAGCTTTCAGGGTCACGGGAATATATCCCTTCAACAACGACCTGTTTACAGAAGCAGACTTTGCACCATCTTCAGTTACAGATATGTTTTGTCCAACTTCTGATACTGTCCTTCAAAATCCGTCTACTTCAAGTTCACTTGGCTTGGATCATCATATTGTATCTGTTGCACCTGTTCCACAAGAATTAGTTGCTTCTGCGTCGGCCGATTTATCAGAAACACAATTTGAGATATCTGATGTTTCGACTGTTGCTGAAGTTCATCACCCATCAAGCTCTCCACTACCTAGAAAACCTAACATCGAAACTGATATACAGAAAGCCAATGAACCATCGCATGCGCTTTCTGATCCAATGGACCAAATAGAAGAATTTCAGGAACAACAAATTATTCCGCCTCCCGTTCTCGGTAACATTTCGAATACTCACAAATCTCATATTCCCTTAATCAATATAAGCCCATTGCCAAAGGCAACTCACATTCAGATACGACGCAAAAATGCCAGCAAATCGGAAATAATCACTAATAGTCCGTTTAAAAATATGTTAGAAGAGAAACAAAAAGAAGTCGACCGAAAATCTAAGAAAATAAGAAAACCAAAGATGAACATGGAAACCAAAACTAAGCCAAAGAAGAAAGATAATATTAAGACTAATACTAAAACTAAAGACAATGACAAGAATAAATGTTCAGAACAAGAGTACTACTGTCCGTTGTGTCAAGAAAAGTACGGAGATACGGCTGAAGCGTGGATTAAATGTTCAATTTGTAGCTCTTGGTGGCACGAAGCCTGCACCAGCTGCGAGAGTGGCATATTTACTTGTGATCTATGTGTAGTAAAAGATTGA
Protein
MPRKYIRKCPDRKVCTQEQIDKAKQLIGEGKSKRAAAEIVGINESTLRKRLKLNSTATSMGRYQQTFTREQEEEIYNHCKSSDERFYGLTLNTLRKLVYEFAEVNEIENRFDKTTKMAGKDWVYEFIKRHPDLALKQTTPTSIARAIGFNQVQVNRFYTNLKKCQEKYNFPPGRIYNMDETGISTVPKKTPKVISLKGKKNVNKIVSGERGQTITAVCCVSATGNYVPPPFIFPRKRMKGELMDGAPTGSIGMTSDSGFINTDLYLEWLHHFKDYTSPTVDNPVLLIIDNHSSHISLQGTLYCRQHNIIVLTLPPHSSHKLQPLDRAIYSPLKSQYAIKADKWMAQHPGRSINQYQVTLIFNRAFLKIATVGNAASAFRVTGIYPFNNDLFTEADFAPSSVTDMFCPTSDTVLQNPSTSSSLGLDHHIVSVAPVPQELVASASADLSETQFEISDVSTVAEVHHPSSSPLPRKPNIETDIQKANEPSHALSDPMDQIEEFQEQQIIPPPVLGNISNTHKSHIPLINISPLPKATHIQIRRKNASKSEIITNSPFKNMLEEKQKEVDRKSKKIRKPKMNMETKTKPKKKDNIKTNTKTKDNDKNKCSEQEYYCPLCQEKYGDTAEAWIKCSICSSWWHEACTSCESGIFTCDLCVVKD

Summary

Pfam
PF03184   DDE_1        + More
PF05225   HTH_psq
PF03221   HTH_Tnp_Tc5
Interpro
IPR004875   DDE_SF_endonuclease_dom        + More
IPR019786   Zinc_finger_PHD-type_CS       
IPR011011   Znf_FYVE_PHD       
IPR009057   Homeobox-like_sf       
IPR007889   HTH_Psq       
IPR013083   Znf_RING/FYVE/PHD       
IPR036880   Kunitz_BPTI_sf       
IPR006600   HTH_CenpB_DNA-bd_dom       
IPR001965   Znf_PHD       
IPR007110   Ig-like_dom       
IPR019787   Znf_PHD-finger       
IPR003599   Ig_sub       
IPR036179   Ig-like_dom_sf       
SUPFAM
SSF57903   SSF57903        + More
SSF46689   SSF46689       
SSF57362   SSF57362       
SSF48726   SSF48726       
Gene 3D

Ontologies

Topology

Subcellular location
Nucleus  
Length:
657
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.31548
Exp number, first 60 AAs:
0
Total prob of N-in:
0.01574
outside
1  -  657
 
 

Population Genetic Test Statistics

Pi
209.284541
Theta
138.075749
Tajima's D
0.105619
CLR
29.723273
CSRT
0.399930003499825
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号