SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03370
Annotation
Pogo_transposable_element_with_KRAB_domain_[Papilio_machaon]
Location in the cell
Nuclear   Reliability : 4.292
 

Sequence

CDS
ATGAAGATGGCCTGGCGTAACATTCTGGTTAAATGGAAAAAAACAGATGGCAAGTCCCAAACATCTCTGCCCAAAGGATGTTTCCCAAAGCTATTAAAAAAACTCATGGAAGACCTCTCTGAAAATGCCAAACAAAATATAATATCTGGTTTTAGGAAGACCGGAATCAAACCTATTGATCCAAATCAGGTTTTGAGTAGACTGCCGGAAGAACTAGATGTAAAAGAAAGTGGAGAAAATGAAGTTGAAAAATCAGTATTAGACATTCTCAAAGAGATGCGGTATGGAACAACTAATATAAACGAACCAAAAAGAAAAAGAAAATTAGAAGTTATACCAGGAAGGAGTGTTGGTTCTTCTGAAGATTATGGAAAAACTGAGGAAGAATCAGAAAATGTAAAGGAAAAAGCCAAGAGAATCGGCAAAAGGACGAAAAAGATAAATAATGAAGAAAGGATTTATGACGAAGAAACGGCGTATTATGATGAAATGGATAAAAAAGTTTATAAAGGCAAGGGTAAAGGAAAAAAAACAAAACGAAATAAAGGCAAAGAAAATGAAGAAAAAAAGGAAATTGTGTATCAGAAAAAAACAGATGATGCTAACTCTTTAAATAATATACAATATACTGAAATTGATTGTTTATCTAATGAAGATATAGAGGCTATGTCCATTACTATTGGAGATTACGTTTTGTATGAAGGAAATGAAATAGTGATAGCCGAGAATTTTACAAGTACGAGTACAGAAGGTAAAGAGAATTTGACACCGAGAATAAAGAAAATTAGTACAAATAATAAAGTAAACATTCTTGCTGACGAAATTATTTCTCCAAGTACTTCGGACAGAAAGATATCAGTTCATTTAAATGAATGGAGACAAATTTCTCCACATTCTTTTGTTAAAACTGCTAATCAACCTAGCACAAGCGGTTCGAAAAGTACTATGGTGCCTGCACCACGATCATCGTACTACACTAAAGATGCTGATATTCTCAAAGATTTGATGGACGATGATATTATATAG
Protein
MKMAWRNILVKWKKTDGKSQTSLPKGCFPKLLKKLMEDLSENAKQNIISGFRKTGIKPIDPNQVLSRLPEELDVKESGENEVEKSVLDILKEMRYGTTNINEPKRKRKLEVIPGRSVGSSEDYGKTEEESENVKEKAKRIGKRTKKINNEERIYDEETAYYDEMDKKVYKGKGKGKKTKRNKGKENEEKKEIVYQKKTDDANSLNNIQYTEIDCLSNEDIEAMSITIGDYVLYEGNEIVIAENFTSTSTEGKENLTPRIKKISTNNKVNILADEIISPSTSDRKISVHLNEWRQISPHSFVKTANQPSTSGSKSTMVPAPRSSYYTKDADILKDLMDDDII

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
341
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0
Exp number, first 60 AAs:
0
Total prob of N-in:
0.03409
outside
1  -  341
 
 

Population Genetic Test Statistics

Pi
60.595196
Theta
120.947363
Tajima's D
-1.429244
CLR
113.506062
CSRT
0.0701964901754912
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号