SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03356
Annotation
PREDICTED:_mucin-2-like_[Amyelois_transitella]
Location in the cell
Nuclear   Reliability : 4.097
 

Sequence

CDS
ATGGAGAAAACTGAAAATACAATTGAAATTCCTATTGAGTGCAAGGCTCCAGCGGAGGAACAGAGAGAAGGAGACGAAAGTAGAACTACAGAAAGTACAGACACTGAATGTGATGATAATGATATCACATATATTCCAGAAGCTTCTTCAGGAAGTGACTCATATGACAGTTTTTCTGAAACACCATCAGAACCAGAACCTTCATTATTAGAATTGAATCAGGATATTCCAAACAAGCGAGTGAGAAAAATACCTGATAGATTTAGCTATAGTCACTTATGTATTGCAGAATCAGATGATCAAAATATAATGGATATTTCACTCAAGGAAGCTTTAAATGGACCTGAAAGTAAATTTTGGAGATCAAGCATGGAGGAGGAATTAGAATCATTTAAGAAAAATGATGCATGGGAACTTGTGGATAAGCCTCGTGACTCTACAGTAGTGCAGTGCAAATGGGTATTTAAAAAGAAGTATGATAGTGTCGGTAATGTGCGTTATCGTGCTAGATTAGTGGCAAAAGGCTTTTCACAGAAAGCTGGCATAGACTATCATGAAACTTTTTCACCTGTGCTACGTTATACTACTTTAAGATTGTTATTTTCTATAGCAGTAAAACTAGGTTTAGATATACGTCATCTTGATGTCACTACAGCCTTTCTAAATGGTTTTTTGAATGAATCTGTGTATATGCAAAAACCTGTCCTTTATAGAGATTGTAATGATAATGATAACAAAGTATTAAAGCTTAAACGTGCCATATATGGACTTAAGCAATCATCTCGTGCTTGGTATCAGAGAGTTAATGATTACTTAGAGTCTTTAGGATATTTAAAATCTAATTAA
Protein
MEKTENTIEIPIECKAPAEEQREGDESRTTESTDTECDDNDITYIPEASSGSDSYDSFSETPSEPEPSLLELNQDIPNKRVRKIPDRFSYSHLCIAESDDQNIMDISLKEALNGPESKFWRSSMEEELESFKKNDAWELVDKPRDSTVVQCKWVFKKKYDSVGNVRYRARLVAKGFSQKAGIDYHETFSPVLRYTTLRLLFSIAVKLGLDIRHLDVTTAFLNGFLNESVYMQKPVLYRDCNDNDNKVLKLKRAIYGLKQSSRAWYQRVNDYLESLGYLKSN

Summary

Pfam
PF07727   RVT_2        + More
PF00665   rve
PF13976   gag_pre-integrs
PF13961   DUF4219
PF00098   zf-CCHC
Interpro
IPR039537   Retrotran_Ty1/copia-like        + More
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
IPR013103   RVT_2       
IPR036397   RNaseH_sf       
IPR001584   Integrase_cat-core       
IPR012337   RNaseH-like_sf       
IPR025724   GAG-pre-integrase_dom       
IPR025314   DUF4219       
SUPFAM
SSF57756   SSF57756        + More
SSF53098   SSF53098       
Gene 3D

Ontologies

Topology

Length:
281
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0212
Exp number, first 60 AAs:
0
Total prob of N-in:
0.07790
outside
1  -  281
 
 

Population Genetic Test Statistics

Pi
116.274871
Theta
117.967429
Tajima's D
-0.045039
CLR
4.980687
CSRT
0.353832308384581
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号