SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03326
Pre Gene Modal
BGIBMGA013209
Annotation
PREDICTED:_dynamin-like_120_kDa_protein?_mitochondrial_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.474
 

Sequence

CDS
ATGATTAACGAGCAGTATCAGCGACTAGTAGAACAAGTAGGCATTCTTCAAGAAGGGGAGGAAGCTGGTGCCCGTTCCCGGACGCCAGCAGGAGTGAAGTCAAAACAAATAAATGAAGAAACAAGAACCAGTGGGCAAAGCCAACAGGTTGAACAAATGAAAAGAAGCCAAGGCACAAACAGTAAATTGGATGATTTCTTAAAAAGACAATATGCTAATTTTAAAGCCTTTATACGAACAACATCAAACATAGACGTAGATTTGATTGCTGATAAATGGGAATTTGAAGACTCTTTAAAAACACTACACGAACGATGGGCTGCTATCGATAGCCTTCACTGGGAAATCGAATCCGAGATGGACGGAGAAAATGAAACATACGCCGCCATGTACGATAGATACGAGAAGAAATTTAATACTCTCAAGAAAACATTGAACACAAAGATGTGGTCGGTAGCTCATAGATCGAATGCTACTCCACAATTGGAAATACCTGTCTTCAGCGGAAATTATAATCAGTGGGTTTCTTTCAAAGATTTATTCACGGAAGCTGTTCACAACAATCCATCTCTATCTAACAGTCAAAAAATGCAACACCTGAAAACTCCGGTGTCAACTGAACAAAACATTGCGAAACAACGCATAACACGAAATGAGAATGTTTCAAAAACCTCTAATGCTTCGCTAAATGAGAGTTCAGAAGTTTTATTAGCTACTGCTTTGGTGAAGGTGAAAGCGGCTGATGGAACCTATTACAACATGCGAGCTTTGTTAGATCAAGGCTCGCAAATATCTTTGATAACTGAAGCAGCAGCCCAAACATTAGGATTAAAGCGTCAAAGATGCAAAGGGGTGATATTTGGTGTAGGCCAAAACGAAAACAGCTGCAAAGGAAAGGTAATCATAGAATGCTCCTCAATTAACAATGACTTCAATTTCGAACTAGAGGCACTCATTATGAACAATTTAATAAAAAGTTTACCAAACAAAACTTTTTCTAAGCCAGCGTGGTCATATTTGAATAATATCAATTTAGCTGATCCCGAGTTTTACAAGAGTCGGCCAGTCGATCTACTGTTCGGTGCGGATATCTACGCTAACATTATTCTGGGAGGAGTGATTAAAGGAGAAACCTTACAACAACCCATGGCTCAACAATCACAGTTAGGATGGTTTTTATGCGGAAGTATTAAAACTTATCATTGTAATGTGGCTCTCAATAACGTGGAAGATATACATAAATTTTGGGAGGTGGAAGAAATCAACGAATCGACGAATATTTCCGTAGAAGATCAGGAATGTATCGACTTTTACTGCTCAACAACAAAACGCATGGAAAATGGTCGATATGAAGTGAGATTGCCTCTAAAGCAAGATTTAAAACATAATTTAGGAATGAAGGCATTCGAAAAGGCGACAACACATTTAGATAAATCATGCAAAGTCCTGGAAGATGGTCAGTGTAGCATAATAGTCGATCAATTGATCCACGAATACAAAGAATTAACTTACTATAATGAGCTACTTATGAATCAACATTTGAATGAGCACTACAGACAGCGTCGTGGTTTTATCAACGGTGTCGGATATCTTGCTAACTCTCTGTTCGGAGTATTAGATGAACATTTCGCAGAAAAATACTCGCAAGACATAGAGCTCGTAAAACATAATGAACAGTACTTAGTGAGTTTATGGAAAAACCAAACTTCGATCGTCGAATCTGAATACAACTTACTAAAAAGAACAGAAGAAGTCATGTCTAAGCAACATAAGACTATTAATAAACACATAACTAACCTAGAAAACATGTCAAATCGACTTCAACAGCAAGTAAACAACATATCGATTCTACAAGAATTTACCTTAATGTCCATTATTACAACTAATTTATTGCACAATTTGAAAGGGTCGCAAAATATATTGTTAGACATTTTAACTAACATACATCATGGTCAATTCAACATTCATTTACTTACTCCAGAACAACTTCAAAAGGAACTAAACATTATCACCGGATATTTACCGGAAGACACAATTCTTCCCGTAGAACCGCAGAATATTAAGAATTTGTATCCTCTGTTAAACATAAAGGCTCGTATTACTCTACAATATTTCTTATTCGAGATAACATTTCCACTCATTTATCAAGATCGATTCAAACTTTATAAAGTACATTCTATTCCTCATCAAAGCGGAAATATGACTATTGAAGTAGTTCCGGCATACGAATACATTGCTACCGACTTGAAAAGAGATTCCTTTCTTGAACTCACCACCGAAGAAGTCTTATCCTGTAATCAACAAGAAGAAGCTTACTACTGCAAGCTTAGAACGCCGATTCTTCATTTACGACCGGAGACTAAGTTTTGTAAGATTAAACTTAATAGCAACGTATGCAAATTAAAGTATTCTAATTGTGAAACCAAAATAATAGCACTAACTCATCTCTCTTTATATTTATATCACTGCTGTGGCACCTGCGAAGTAAAGGTCATGTGCGGAGAACATATTGCCTTGAAACAGTTGAATAACACTGGTCGTCTGTATCTAGAGCCAGGTTGCCTCATAAAGGGATCAGATTATACACTTCATATCCCTAAAACAAACAACAATAAGCTGGAGATTCAGTCTAACATTTACGTTCCAATAATAGATCCCATAAATAATATCATAAACAGCTCTCTTCTCAACACTGAGAACCTGAATGTCAGCGAGTCTAAAGATTTGCAGAACGCTCTCCAGAAACTACACGTGCGTATTGAAGATCTAGAAAACTCCCCGCCAGTATTGGAGACTTCATTAACATCTCACGATATTCATCAGTATGTGATAACATACATCATCGTCATCGTCATCGTGCTGGCCACCGGCGTGCTACTCTGGCGACGACGACGGTTGAGTGCGAACCGGGCGATCATCTCTGACGGCATCGAGCTTCAACAGTATAGTGAATGTGAAAATGTAAATAGTGCTAAGGCAGGGTTTAGTGCGCGACCTTCTGTGGTGGACCCTTCGCCTGGTGATGTGAACATTTATGCCAAAGTGTCAAACAAAGCGTGCTCTCCAATACCAAGAAAACCTATATGGACCCTAAGTTCTTAA
Protein
MINEQYQRLVEQVGILQEGEEAGARSRTPAGVKSKQINEETRTSGQSQQVEQMKRSQGTNSKLDDFLKRQYANFKAFIRTTSNIDVDLIADKWEFEDSLKTLHERWAAIDSLHWEIESEMDGENETYAAMYDRYEKKFNTLKKTLNTKMWSVAHRSNATPQLEIPVFSGNYNQWVSFKDLFTEAVHNNPSLSNSQKMQHLKTPVSTEQNIAKQRITRNENVSKTSNASLNESSEVLLATALVKVKAADGTYYNMRALLDQGSQISLITEAAAQTLGLKRQRCKGVIFGVGQNENSCKGKVIIECSSINNDFNFELEALIMNNLIKSLPNKTFSKPAWSYLNNINLADPEFYKSRPVDLLFGADIYANIILGGVIKGETLQQPMAQQSQLGWFLCGSIKTYHCNVALNNVEDIHKFWEVEEINESTNISVEDQECIDFYCSTTKRMENGRYEVRLPLKQDLKHNLGMKAFEKATTHLDKSCKVLEDGQCSIIVDQLIHEYKELTYYNELLMNQHLNEHYRQRRGFINGVGYLANSLFGVLDEHFAEKYSQDIELVKHNEQYLVSLWKNQTSIVESEYNLLKRTEEVMSKQHKTINKHITNLENMSNRLQQQVNNISILQEFTLMSIITTNLLHNLKGSQNILLDILTNIHHGQFNIHLLTPEQLQKELNIITGYLPEDTILPVEPQNIKNLYPLLNIKARITLQYFLFEITFPLIYQDRFKLYKVHSIPHQSGNMTIEVVPAYEYIATDLKRDSFLELTTEEVLSCNQQEEAYYCKLRTPILHLRPETKFCKIKLNSNVCKLKYSNCETKIIALTHLSLYLYHCCGTCEVKVMCGEHIALKQLNNTGRLYLEPGCLIKGSDYTLHIPKTNNNKLEIQSNIYVPIIDPINNIINSSLLNTENLNVSESKDLQNALQKLHVRIEDLENSPPVLETSLTSHDIHQYVITYIIVIVIVLATGVLLWRRRRLSANRAIISDGIELQQYSECENVNSAKAGFSARPSVVDPSPGDVNIYAKVSNKACSPIPRKPIWTLSS

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
1033
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
21.60058
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00023
outside
1  -  938
TMhelix
939  -  961
inside
962  -  1033
 
 

Population Genetic Test Statistics

Pi
396.005246
Theta
209.331736
Tajima's D
1.964368
CLR
113.987336
CSRT
0.87835608219589
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号