SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03307  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA006419
Annotation
PREDICTED:_malate_dehydrogenase_isoform_X1_[Bombyx_mori]
Full name
Malic enzyme      
Location in the cell
Cytoplasmic   Reliability : 1.356
 

Sequence

CDS
ATGGAATATTTGTCGCGCACTATGAATGGCAACAGCGGCAAATGTCAAGTTAATGGCACGGTCCGCGACATTCGGGAAATGAAAAGGAGCGAATCCGCAATGAGTCCAGCGCCCCCCGCTCACTGTAACAAAACTGGCGTTCCGTTCTCGGCAGTCAAGCAGTCGCAAGCGACAAGCGGAGGGAAGTGTACGTATAGCGAAATGGAACGTGATCGTATCGGATTATGGGGCTCCGGGGACGGACAGCCCACCAGCGGCCTCTCCGGCCTCGACCACCTCAAGCACCCCGGCCTCAACAAGGGTATGGCTTTTACCATCGAAGAGCGTCAGCTCTTGGGGATCCACGGGTTGTTACCACCACGAGTCAAGACGCAAGAGGAGCAGGTTGAACTATGCAAGCTCTCGATCGACAGATACGAAAATCCACTTAACAAGTACATCTATCTTATGGGGCTCTTGGACCGCAATGAGCATCTGTTCTACCGTTTCGTCGCGGATAACGTGGCTGAAATGATGCCAATTGTGTACACTCCGACGGTTGGCCTGGCCTGTCAGAAGTTCGGCCTTGTGTACCGCCGACCAAGGGGCCTCTTCATCACGATCCACGATAAGGGACATGTATACGATGTTCTTAAGAACTGGCCGGAGACGGACGTCCGCGCCATTGTTGTAACCGACGGAGAACGTATTCTGGGTCTGGGCGACTTGGGCGCATGCGGGATGGGCATCCCTGTGGGCAAACTCGCGCTCTACACCGCGCTCGGAGGCATCAAGCCGCATCAGTGTCTGCCCATCACTATCGACGTGGGTACGAACACCCAGTCGATGCTGGACGACCCGCTGTACATCGGGCTCCGGCAGCGGCGCGTGCGCGGCCCCGACTACGACGAGCTGCTCGACGAGTTCATGCGCGCCGTCGTGCGCCGCTACGGGCAGAACTGTCTCGTGCAGTTCGAGGACTTCGGGAACGCTAACGCTTTTAGGCTCCTCGAGAAGTACAGGAACAAGTACTGCACTTTCAACGACGACATCCAGGGGACGGCGGCCGTGGCGGTGGCGGGACTACTCGCCAGTCTCAGACTCACACAGAAGAGGCTGTCCGACAACGTCATCGTCTTCCAGGGAGCCGGAGAGGCCGCTTTGGGTATCGCGGAGCTGTGCGTTATGGCCATGAAGGGCGAGGGCACGCCGGAGCAGGAGGCGAGGTGCCGCATCTGGATGGTGGACTCGAAGGGCCTCATCGTCAAGAACAGACCGGAGGGAGGGCTTAACGTTCACAAGGAGAGGTTCGCTCAGGACCACGCGCCCGTCAGGACCTTGGCAGAAGTTGTGGAAGTGGCCAGACCATCAGTGCTTATTGGAGCGGCCGCCATCGGTGGTGCTTTCACTCCTGAGATATTGAGGAAGATGGCAAACTTCAACGAGAAGCCAGTCATCTTCGCTCTCTCGAACCCCACCAGCAAGGCGGAGTGTACCGCTGAAGAAGCCTACAGTAACACCGACGACCGTGCTATATTCGCGTCGGGGTCACCGTTCCCGGAGTACCGCAGTAAGTCGGGCGCGTTGTTCCGCCCGGGACAAGGCAACAACTCGTACATCTTCCCGGGACTCGCGCTCGGCATCATCTGCGCCGGGATACTGGACATCTCGGACGACTTCATGCTACTCGCCGCCGAGGCTTTAGCGGAAATTGTGTCGGATGATGATCTCGCATACGGAAGCTTGTACCCGCCTCTGCACATGATAAAGGATTGTTCCGTTAAGATCGCGAAGAAGATTGTCGAACACGCCTACAATACAGGCAAGGCGTCGGTGCAGCCGCAGCCGCTCGACACGGAGGAGTTCATCCGCGCGCAGATGTACAGCGTGGAGTACGGCGCCGCGCTGCCGCCCGCCTACCCGTGGCCGGACAACCAGCCGCGGGTCGCGATCATCTAA
Protein
MEYLSRTMNGNSGKCQVNGTVRDIREMKRSESAMSPAPPAHCNKTGVPFSAVKQSQATSGGKCTYSEMERDRIGLWGSGDGQPTSGLSGLDHLKHPGLNKGMAFTIEERQLLGIHGLLPPRVKTQEEQVELCKLSIDRYENPLNKYIYLMGLLDRNEHLFYRFVADNVAEMMPIVYTPTVGLACQKFGLVYRRPRGLFITIHDKGHVYDVLKNWPETDVRAIVVTDGERILGLGDLGACGMGIPVGKLALYTALGGIKPHQCLPITIDVGTNTQSMLDDPLYIGLRQRRVRGPDYDELLDEFMRAVVRRYGQNCLVQFEDFGNANAFRLLEKYRNKYCTFNDDIQGTAAVAVAGLLASLRLTQKRLSDNVIVFQGAGEAALGIAELCVMAMKGEGTPEQEARCRIWMVDSKGLIVKNRPEGGLNVHKERFAQDHAPVRTLAEVVEVARPSVLIGAAAIGGAFTPEILRKMANFNEKPVIFALSNPTSKAECTAEEAYSNTDDRAIFASGSPFPEYRSKSGALFRPGQGNNSYIFPGLALGIICAGILDISDDFMLLAAEALAEIVSDDDLAYGSLYPPLHMIKDCSVKIAKKIVEHAYNTGKASVQPQPLDTEEFIRAQMYSVEYGAALPPAYPWPDNQPRVAII

Summary

Similarity
Belongs to the malic enzymes family.
EMBL
DQ443377    ABF51466.1    BABH01009001    BABH01009002    BABH01009003    GAIX01004843    + More
JAA87717.1    KQ459579    KPI99384.1    KZ149939    PZC76970.1    AGBW02010641    OWR48133.1    ODYU01002375    SOQ39791.1    KQ460685    KPJ12903.1    NWSH01005759    PCG63968.1    KQ971310    EEZ99126.1    GEDC01022082    GEDC01013651    JAS15216.1    JAS23647.1    GEDC01020404    GEDC01002355    JAS16894.1    JAS34943.1    GEDC01031481    JAS05817.1    GEDC01010314    JAS26984.1    GECZ01030907    JAS38862.1    NNAY01002100    OXU22086.1    KC118983    AGC84405.1    GALX01004841    JAB63625.1    GBYB01004236    JAG74003.1    GBYB01004237    JAG74004.1    GECZ01013091    JAS56678.1    NEVH01020327    PNF21941.1    JR038797    AEY58419.1    JR038798    AEY58420.1    GEDC01000017    JAS37281.1    GEDC01017964    JAS19334.1    GEDC01018570    JAS18728.1    UFQS01000467    UFQT01000467    SSX04242.1    SSX24607.1    GL440813    EFN65360.1    KK107681    QOIP01000006    EZA48085.1    RLU21546.1    GEDC01025824    JAS11474.1    KQ434851    KZC08613.1    KQ982294    KYQ58184.1    KQ980107    KYN17664.1    GDIQ01081394    JAN13343.1    KQ977793    KYM99669.1    CH477359    EAT42717.1    GDIQ01268247    GDIQ01084393    JAJ83477.1    GDIQ01148090    JAL03636.1    GDIP01211225    GDIP01211224    JAJ12177.1    GDIP01239231    GDIP01239230    JAI84171.1    GDIP01182970    JAJ40432.1    GDIQ01084394    JAN10343.1    GDIP01252066    GDIP01252065    GDIP01252064    GDIP01251068    GDIP01251067    GDIP01251066    GDIP01157682    GDIP01157681    GDIP01150935    GDIP01135438    GDIP01135437    GDIP01135436    GDIP01115092    GDIP01114991    GDIP01113393    GDIP01113392    GDIP01047049    GDIP01047007    JAJ65720.1    GDIQ01084392    JAN10345.1    GL888480    EGI60294.1    GDIP01182971    JAJ40431.1    GDIP01197987    JAJ25415.1    GDIP01231570    GDIP01162831    GDIP01161834    GDIP01161833    JAJ61569.1    GDIP01116329    GDIP01113394    GDIP01054550    GDIP01054549    GDIP01048547    GDIP01048546    JAM49166.1    GFDL01005635    JAV29410.1    GFDL01005611    JAV29434.1    KQ976574    KYM80267.1    GDIP01254156    JAI69245.1    GDIP01254817    GDIP01254816    GDIP01252013    GDIP01230317    GDIP01230272    GDIP01219021    GDIP01219020    GDIP01213924    GDIP01197073    GDIP01186837    GDIP01185621    GDIP01175089    GDIP01162830    GDIP01161832    GDIP01143431    GDIP01143430    GDIP01142330    GDIP01142329    GDIP01142328    GDIP01141284    GDIP01141283    GDIP01141282    GDIP01139184    GDIP01139183    GDIP01139182    GDIP01131741    GDIP01131740    GDIP01131739    GDIP01128626    GDIP01127335    GDIP01127334    GDIP01127333    GDIP01125950    GDIP01125949    GDIP01125948    GDIP01125947    GDIP01099085    GDIP01099084    GDIP01097700    GDIP01096446    GDIP01096445    GDIP01096444    GDIP01076391    GDIP01074950    GDIP01072485    JAL61385.1    GDIP01230318    JAI93083.1    GDIQ01022959    JAN71778.1    GDIP01254815    JAI68586.1    GDIP01254155    JAI69246.1    GDIP01253961    GDIP01253960    GDIP01231569    JAI69440.1    KQ981625    KYN39093.1    GDIP01150989    JAJ72413.1    GDIP01150987    GDIP01150934    JAJ72415.1    GANO01001561    JAB58310.1    ADTU01015189    GDIP01219019    JAJ04383.1    KQ765373    OAD53959.1    GL732551    EFX79712.1    PNF21942.1    GDIQ01037401    JAN57336.1    DS232187    EDS37030.1    DS235250    EEB13942.1    GFDG01003843    JAV14956.1    GFDG01003840    JAV14959.1    GFDG01003841    JAV14958.1    GDIP01239229    JAI84172.1    GFDG01003842    JAV14957.1    DQ440412    ABF18445.1    GFDG01003844    JAV14955.1    GDIP01226524    JAI96877.1    GFDG01003839    JAV14960.1    GEZM01054602    JAV73532.1    GDKW01002495    JAI54100.1    ABLF02026861    GDIP01021514    JAM82201.1    KB631801    ERL86223.1    GGFL01000395    MBW64573.1    GAMD01001655    JAA99935.1    GEDC01012664    JAS24634.1    GGFM01006487    MBW27238.1    GEDC01008171    JAS29127.1    AAAB01008846    EGK96513.1    APCN01003927   
Pfam
PF00390   malic        + More
PF03949   Malic_M
PF05276   SH3BP5
Interpro
IPR037062   Malic_N_dom_sf        + More
IPR001891   Malic_OxRdtase       
IPR012302   Malic_NAD-bd       
IPR015884   Malic_enzyme_CS       
IPR012301   Malic_N_dom       
IPR036291   NAD(P)-bd_dom_sf       
IPR007940   SH3BP5       
SUPFAM
SSF51735   SSF51735       
Gene 3D
PDB
1GQ2     E-value=0,     Score=1734

Ontologies

Topology

Length:
645
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.02656
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00719
outside
1  -  645
 
 

Population Genetic Test Statistics

Pi
275.444784
Theta
192.679226
Tajima's D
1.097855
CLR
0.537979
CSRT
0.68341582920854
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
25044914 AQMTDYDR 95.83 1e-10
24402669 AQKHDDQQITQQIQNSDDIQQGNNQFEK 95.83 1e-10
26822097 VRGPDYDEIIDEFMR 95.83 1e-10
25860555 DVFAFR 95.83 1e-10
25044914 FTYYDMQIPQSEFEVQDIYKEEEVR 95.83 1e-10
24402669 FTYYDMQIPQSEFEVQDIYKEEEVR 95.83 1e-10
26822097 ASVQPQPIDTEEFIR 100.00 2e-04
25860555 MQIIDGHYK 100.00 2e-04
26280517 ACNCIIIK 100.00 2e-04
25044914 AEAVTSFYNDVVGK 100.00 2e-04
24093152 AEASTIYASFR 100.00 2e-04
24402669 AECPCVESFMTYPVGSTFR 100.00 2e-04
28467696 AECPCVESFMTYPVGSTFR 100.00 2e-04
29197581 TGQYSEDKAFK 100.00 2e-04
26822097 TQEEQVEICK 100.00 0.021
25860555 TVIDDYSSQAHAEK 100.00 0.021
25044914 AIEYISPAIEVSAGDK 100.00 0.021
24093152 AIEVDGVIAFYSAK 100.00 0.021
24402669 AIETVHNNIK 100.00 0.021
27102218 GHVYDVIK 100.00 0.021
28467696 AIEYIFPSGIYDPAAR 100.00 0.021
29197581 AECTAEEAYSNTDDR 100.00 0.021
28556443 AEYNAIPLK 100.00 0.021
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号